Primer, probe and kit for detecting neocoronavirus SARS-CoV-2

A sars-cov-2 and kit technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of low detection accuracy

Active Publication Date: 2021-05-07
CHANGCHUN INST OF APPLIED CHEMISTRY - CHINESE ACAD OF SCI
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the problems of low detection accuracy and high requirements for detection equipment and detection personnel in the detection method of the ne

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and kit for detecting neocoronavirus SARS-CoV-2
  • Primer, probe and kit for detecting neocoronavirus SARS-CoV-2
  • Primer, probe and kit for detecting neocoronavirus SARS-CoV-2

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0060] The preparation method of the above-mentioned M-hCG-P1 comprises the following steps:

[0061] Step 1, modifying the M-P1 sequence to BG to prepare the M-BG-P1 sequence

[0062] Mix the M-P1 probe, BG-GLA-NHS, and HEPES in the solvent, incubate with shaking at room temperature for 2-2.5 hours, and separate on a desalting column to obtain the M-BG-P1 sequence.

[0063] The substance ratio of M-P1 probe, BG-GLA-NHS, and HEPES is 1:30:200;

[0064] Step 2: Preparation of hCG-SNAP fusion protein

[0065] HEK293T cells were transfected with pcDNA3.4-hCG-SNAP-His using PEI transfection reagent, and the cell supernatant was collected after 48 hours of culture, and the cell supernatant was filtered with a 0.45 μm filter, separated by an affinity chromatography column, and dialyzed to obtain hCG-SNAP fusion protein;

[0066] Step 3: Complete the connection between M-BG-P1 and hCG-SNAP fusion protein

[0067] Mix the hCG-SNAP fusion protein with the M-BG-P1 probe according to...

Embodiment 1

[0094] The M gene primers used to detect the new coronavirus SARS-CoV-2 are M-F3, M-B3, M-FIP, M-BIP and M-LP according to the material ratio of 1:1:4:4:2 wherein, the sequence of M-F3 is TAGGCTTGATGTGGCTCA; the sequence of M-B3 is AAGATGTCCACGAAGGATC; the sequence of M-FIP is CTGGATTGAATGACCACATGGAAGCTACTTCATTGCTTCTTTCAG; the sequence of M-BIP is ACATTCTTCTCAACGTGCCACACAGCTCCGATTACGAGTT; the sequence of M-LP is CGCGTACGCGCAAACAGT.

[0095] Amplify the M gene sequence of SARS-CoV-2 new coronavirus based on RT-LAMP method: use 25 μL RT-LAMP reaction system: 1×Isothermol Buffer contains 4 μL of the analyte, 0.6 μM M-B3, 0.6 μM M-F3, 2.4 μM M-FIP, 2.4 μM M-BIP, 1.2 μM M-LP, 1.12 mM dNTPs, 2MmMgSO 4 , 1mM betaine, 12UBst 2.0polymerase, 7.5UwarmstartRTx Reverse Transcriptase (when the pUC57-M plasmid is used as the test object, this reverse transcriptase is not added). The reaction conditions are as follows: first react at 58°C for 1.5h, then react at 80°C for 20min. The reaction...

Embodiment 2

[0101] The N gene primers used to detect the new coronavirus SARS-CoV-2 are N-F3, N-B3, N-FIP, N-BIP and N-LP according to the ratio of the substance to 1:1:4:4:2 wherein, the sequence of N-F3 is TTGGCTACTACCGAAGAGCT; the sequence of N-B3 is TGCAGCATTGTTAGCAGGATT; the sequence of N-FIP is CTGGCCCAGTTCCTAGGTAGTACAGACGAATTCGTGGTGGTG; the sequence of N-BIP is GACGGCATCATATGGGTTGCAAGCGGGTGCCAATGTGAT;

[0102] Amplify the N gene sequence of SARS-CoV-2 new coronavirus based on RT-LAMP method: use 25 μL RT-LAMP reaction system: 1×Isothermol Buffer contains 4 μL of the analyte, 0.6 μM N-B3, 0.6 μM N-F3, 2.4 μM N-FIP, 2.4 μM N-BIP, 1.2 μM N-LP, 1.12 mM dNTPs, 4 mM MgSO 4 , 0.6mM betaine, 12U Bst 2.0polymerase, 3.75U WarmstartRTx Reverse Transcriptase (when the pUC57-N plasmid is used as the test object, this reverse transcriptase is not added). The reaction conditions are as follows: first react at 58°C for 1.5h, and then react at 80°C for 20min. The reaction device adopts an isother...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a primer, a probe and a kit for detecting neocoronavirus SARS-CoV-2, and belongs to the technical field of kits. The problems that in the prior art, a neocoronavirus SARS-CoV-2 detection method is low in detection accuracy and high in requirement for detection equipment and detection personnel are solved, and the detection sensitivity and specificity are improved. The M gene primer comprises M-F3, M-B3, M-FIP, M-BIP and M-LP; and the N gene primer comprises N-F3, N-B3, N-FIP, N-BIP and N-LP. The invention further provides the probe and the kit for detecting the neocoronavirus SARS-CoV-2. According to the primer, the probe and the kit for detecting the SARS-CoV-2, no precise large detection instrument or professional operator is needed, the on-site instant diagnosis requirement is met, the cost is low, the high detection accuracy and sensitivity are achieved, and the false positive and false negative diagnosis is avoided.

Description

technical field [0001] The invention belongs to the technical field of kits, and in particular relates to a primer, a probe and a kit for detecting the new coronavirus SARS-CoV-2. Background technique [0002] New coronary pneumonia is a new acute infectious pneumonia that can be transmitted from person to person, and can eventually lead to the death of patients. The new crown pneumonia epidemic has now taken on the characteristics of a global pandemic. In order to better prevent and control the epidemic and avoid cross-infection, it is urgent to carry out accurate on-site real-time detection methods for suspected infected persons in the early stage of infection. [0003] In the prior art, the in vitro nucleic acid detection of the new coronavirus is mainly used to determine whether it is infected with the new coronavirus. The detection principle of the currently widely used detection method is based on reverse transcription-polymerase chain reaction (RT-PCR). The operati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6844C12Q1/6811C12N15/11
CPCC12Q1/701C12Q1/6844C12Q1/6811C12Q2531/119C12Q2521/107C12Q2537/1376C12Q2565/625C12Q2525/117Y02A50/30
Inventor 杜衍李冰凌杨媚婷唐艺丹
Owner CHANGCHUN INST OF APPLIED CHEMISTRY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap