Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene mutation detection kit based on high-resolution melting curve of non-fluorescence labeled probe, detection method and application of gene mutation detection kit

A high-resolution melting and detection kit technology, applied in the field of biomedicine, can solve the problems of inability to detect clinical specimens on a large scale at the same time, low clinical popularity, and difficult operation, and achieve simple and intuitive interpretation, low detection cost, and simple operation. fast effect

Pending Publication Date: 2021-05-11
HANGZHOU DIAN BIOTECH CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims to overcome the defects of high instrument price, difficult operation, certain false negatives and false positives, high detection cost, low clinical popularity and inability to detect clinical specimens on a large scale in the existing methods for detecting gene mutations, and provides A gene mutation detection kit, detection method and its application based on the high-resolution melting curve of non-fluorescent labeled probes are developed to solve the problems of complicated operation, high cost and easy false positive in previous detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene mutation detection kit based on high-resolution melting curve of non-fluorescence labeled probe, detection method and application of gene mutation detection kit
  • Gene mutation detection kit based on high-resolution melting curve of non-fluorescence labeled probe, detection method and application of gene mutation detection kit
  • Gene mutation detection kit based on high-resolution melting curve of non-fluorescence labeled probe, detection method and application of gene mutation detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Composition of Human MTHFR Gene Polymorphism Detection Kit (Unlabeled Probe Method)

[0053] (1) The SNP site rs1801133 on the MTHFR coding gene was typed by the high-resolution melting curve gene mutation detection method based on non-fluorescent labeled probes. According to the distribution of mutation sites in the corresponding gene sequences, design unlabeled probes covering these mutation sites, and then design primer pairs for specific amplification of target sequences according to the distribution of probes, which contain the site, the length of the amplified fragment between the primers corresponding to the MTHFR gene sequence is 105bp.

[0054] Primer sequence:

[0055] Primer 1: TGAGGCTGACCTGAAGCAC

[0056] Primer 2: GCCTTCACAAAGCGGAAGA

[0057] Unlabeled probe sequence:

[0058] Probe 1: TCTGCGGGAGCCGATTTCATC

[0059] (2) The preparation process of the kit is as follows:

[0060] Prepare PCR reaction solution:

[0061] Single site reaction solution per...

Embodiment 2

[0078] Composition of Human ALDH2 Gene Polymorphism Detection Kit (Unlabeled Probe Method)

[0079] (1) The high-resolution melting curve gene mutation detection method based on non-fluorescent labeled probes was used to type the SNP site rs671 on the ALDH2 coding gene. According to the distribution of mutation sites in the corresponding gene sequences, design unlabeled probes covering these mutation sites, and then design primer pairs for specific amplification of target sequences according to the distribution of probes, which contain the site, the length of the amplified fragment between the primers corresponding to the ALDH2 gene sequence is 149bp.

[0080] Primer sequence:

[0081] Primer 3: GAGCCCAGTCACCCCTTTG

[0082] Primer 4: ACCAGCAGACCCTCAAGC

[0083] Unlabeled probe sequence:

[0084] Probe 2: CAGGCATACACTGAAGTGAA

[0085] (2) The preparation process of the kit is as follows:

[0086] Prepare PCR reaction solution:

[0087] Single site reaction solution per p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biomedicine, in particular to a gene mutation detection kit based on a high-resolution melting curve of a non-fluorescence labeled probe, a detection method and application of the gene mutation detection kit. The kit comprises a system composed of a non-fluorescence labeled probe, two forward and reverse amplification primers, a DNA polymerase with 5 '-3' exonuclease activity deletion, a fluorescent dye, a dNTP mixed solution and a PCR buffer solution. Wherein the non-fluorescence labeled probe is a non-fluorescence labeled probe of which the 3'end is blocked by group modification and thus loses the ability to extend. According to the detection system, common oligonucleotide is used for replacing an expensive fluorescent probe for nucleic acid recognition, the purpose of gene polymorphism detection is achieved, a non-fluorescence labeled probe is combined with a target sequence with a mutation site, and sequences at different melting temperatures are converted into signal generation through melting curve analysis, so that rapid detection of gene mutation is realized through the non-fluorescence labeled probe.

Description

technical field [0001] The invention relates to the field of biomedical technology, in particular to a gene mutation detection kit, detection method and application thereof based on a high-resolution melting curve of a non-fluorescent labeled probe. Background technique [0002] The study of gene mutation has become one of the hotspots in life science research, and the detection methods have also developed rapidly. The mutation types of human cell oncogenes have been mentioned above. For the detection of gene mutations, before 1985, the Southern blot method could be used to screen out gene mutations such as deletion, insertion, and frameshift recombination. For mutations that cannot be detected by this method, complex and time-consuming DNA sequence analysis methods can only be applied. Polymerase chain reaction (polymerase chain reaction PCR) technology is the most significant progress in mutation research, which has made great progress in gene mutation detection technolog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858
CPCC12Q1/6858C12Q2531/113C12Q2563/107C12Q2527/107
Inventor 倪晓龙张若兰王荣霞焦明超余序明
Owner HANGZHOU DIAN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products