Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction of lipid metabolism disorder animal model and repair using AAV-CRISPR/CAS9

A lipid metabolism disorder, animal model technology, applied in metabolic diseases, DNA/RNA fragments, applications, etc., can solve the problem of difficulty in successfully preparing stable, seldom targeted therapeutic drugs, and no development of lipid metabolism disorder-related protein drugs. And other issues

Inactive Publication Date: 2021-05-18
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although a considerable number of gene-disease correlations have been understood, few targeted therapeutics have been successfully developed, and some are only at the theoretical research stage.
At present, the successful establishment of animal models using CRISPR / Cas9 is also difficult to successfully prepare or have poor stability due to problems such as off-target
[0005] In summary, no drug based on gene editing technology and targeting proteins related to lipid metabolism disorders has been developed in this field.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of lipid metabolism disorder animal model and repair using AAV-CRISPR/CAS9
  • Construction of lipid metabolism disorder animal model and repair using AAV-CRISPR/CAS9
  • Construction of lipid metabolism disorder animal model and repair using AAV-CRISPR/CAS9

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0047] Preparation and application of animal models

[0048] The present inventor is committed to the establishment of animal models of lipid metabolism disorders, and has carried out multi-target and multi-faceted analysis in the previous research work, and finally located the nonsense expression of the low-density lipoprotein receptor (Low-density lipoprotein receptor, LDLR) gene. Mutation, using it as a target, combined with CRISPR / Cas technology to prepare animal models. In the process of designing the animal model, the inventors conducted repeated analysis and research and experimental verification on the sequence position corresponding to the vicinity of the 208 site, and found that at this site and its vicinity, inappropriate position selection will lead to The targeting efficiency is low, the off-target efficiency is high, useful animal models cannot be obtained, the symptoms of animal models are not typical, or animals produce some other abnormal reactions. After tri...

Embodiment 1

[0083] Example 1. Low-density lipoprotein receptor variation and its pathogenic mechanism

[0084] The present inventor identified a nonsense variation of the low-density lipoprotein receptor (Low-density lipoprotein receptor, ldlr) gene from the patient family, and the variation occurred on the codon of the 207th amino acid of LDLR, which was determined by G AG mutated to T AG, causing the protein to undergo the E207X mutation (X indicates codon termination), the nonsense mutation at this site can cause LDLR amino acid coding and premature termination of peptide chain synthesis ( figure 1 A). This mutation is the pathogenic variant in familial hypercholesterolaemia. Mouse-derived LDLR is highly conserved with human-derived LDLR. In mouse-derived LDLR, this site is at position 208, such as figure 1 b.

[0085] The nucleotide sequence corresponding to the 207th amino acid position of LDLR and its vicinity is as follows (the mutation position is underlined):

[0086] TGTGGT...

Embodiment 2

[0100] Example 2, Gene Reversion and Disease Correction

[0101] After elucidating the pathological process of the disease and the pathological molecular mechanism involved in the regulation, the inventors then tried to perform gene reversion and disease correction.

[0102] The present inventors used adeno-associated virus (AAV) to package Cas9, and attempted point mutation gene reversion and disease correction. The present inventors packaged Cas9 plasmid, sgRNA and Donor into adeno-associated virus AAV8 respectively, and obtained AAV8-TBG-Cas9 and AAV8-U6-sgRNA-Donor ( image 3 A), AAV8-Cas9 and AAV8-sgRNA-Donor are abbreviated in the figure. In the Cas9 plasmid construction, the specific elements and their connection sequence are as follows ( image 3 A):

[0103] ITR-TBG-Flag-NLS-Cas9-NLS-ITR;

[0104] ITR-U6-sgRNA-Donor-ITR;

[0105] Wherein the sgRNA sequence is: GGGCTGCTAACGCCTTTGGAGG (SEQ ID NO: 4); (the underline is the PAM sequence of the sgRNA)

[0106] Wherei...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction of a lipid metabolism disorder animal model and repair using AAV-CRISPR / CAS9. According to the invention, the animal model with typical lipid metabolism disorder disease symptoms is constructed, a construct capable of repairing a low-density lipoprotein receptor in a targeted manner and inhibiting lipid metabolism disorder diseases is further constructed, and a virus obtained by packaging can continuously and effectively repair the low-density lipoprotein receptor, the action time is long, and stability is good.

Description

technical field [0001] The invention belongs to the field of biomedicine, and more specifically, the invention relates to the establishment of an animal model of lipid metabolism disorder and the repair using AAV-CRISPR / CAS9. Background technique [0002] Cardiovascular disease is one of the most harmful diseases in the world, and is the leading cause of human death, especially myocardial infarction and stroke caused by atherosclerosis have become the leading cause of death in China. Familial hypercholesterolemia (FH) is an autosomal dominant genetic disease with familial characteristics, the incidence rate is about 1 / 200-1 / 500, and the main clinical manifestations of patients are low-density lipoprotein in plasma Cholesterol value (LDL-C) is abnormally high, causing cholesterol to deposit in the skin, tendons, and coronary arteries, causing xanthelasma, xanthelasma, and atherosclerosis, threatening the lives of patients. Familial hypercholesterolemia is usually caused by p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/864C12N15/90C12N7/01A01K67/027A61K48/00A61P3/04A61P3/06A61P9/10
CPCC12N15/113C12N15/86C12N15/902C12N7/00A01K67/0276A61K48/005A61K48/0008A61P3/06A61P9/10A61P3/04C12N2750/14143C12N2750/14121C12N2310/20C12N2800/22A01K2207/15A01K2207/25A01K2217/075A01K2227/105A01K2267/0362
Inventor 周斌赵欢
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com