Single-domain antibody specifically bound with insect BBMV, recombinant antibody, coding gene, preparation method and application

A single-domain antibody and recombinant antibody technology, applied in the field of genetic engineering and pest control, to achieve the effect of small molecular weight, delayed evolution, and improved control effect

Active Publication Date: 2021-06-11
JIANGSU ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at problems such as the widespread resistance of Bt crops and Bt preparations and the limitations of existing Bt synergists, the present invention provides a recombinant antibody that has a synergistic effect on Bt toxin, a gene encoding the recombinant antibody, and Its preparation method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-domain antibody specifically bound with insect BBMV, recombinant antibody, coding gene, preparation method and application
  • Single-domain antibody specifically bound with insect BBMV, recombinant antibody, coding gene, preparation method and application
  • Single-domain antibody specifically bound with insect BBMV, recombinant antibody, coding gene, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0036] In the present invention, the recombinant antibody is preferably produced through prokaryotic expression. In the present invention, the specific preparation method preferably includes the following steps: cloning the gene encoding the recombinant antibody into an expression vector to obtain a recombinant vector, then transferring the recombinant vector into a host bacterium to obtain a recombinant strain, and inducing the The recombinant antibody is obtained by expressing the recombinant strain.

[0037] In the present invention, the expression vector is preferably pET-26b(+) vector; the host bacteria is preferably E.coliBL21(DE3). In the present invention, the steps of synthesizing the gene encoding the recombinant antibody, preparing the recombinant vector and transferring the recombinant vector into host cells are preferably entrusted to a biological company. In the present invention, after the recombinant strain is obtained, sequencing verification is preferably pe...

Embodiment 1

[0043] The human single-domain antibody library in the form of TG1 host bacteria purchased from the British Source BioScience company was rescued into a phage display antibody library using KM13 assisted phage (see the literature (Selection of human antibody fragments by phage display, NATURE PROTOCOLS|VOL.2NO. 11|200, doi: 10.1038 / nprot.2007.448) were carried out); the phage display library was used for targeted screening of Plutella xylostella BBMV.

[0044] The preparation process of Plutella xylostella BBMV is as follows: the larvae of Plutella xylostella xylostella on the second day of the 4th instar were dissected, the dissected midgut tissue was cleaned with 0.15M sodium chloride, and then placed in an EP tube placed on ice. Good samples were placed in a -80°C refrigerator for later use. BBMV is obtained by the Mg-EGTA sedimentation method, and the specific operation steps can be found in references: Wolfersberger M, Luethy P, Maurer A, et al. Preparation and partial ch...

Embodiment 2

[0050] Bispecific single chain antibody 4C1V H -2D3V L Prokaryotic expression of (recombinant antibody)

[0051] 2D3 is a monoclonal antibody that can broadly recognize Cry1A toxoid (see references for details: Construction, Expression, and Identification of Double Light Chain (V L -V L ) Antibody from a Unique Bt Cry1-Specific Monoclonal Antibody, Food Anal. Methods (2020) 13:1570–1582, https: / / doi.org / 10.1007 / s12161-020-01754-y), the light chain of 2D3 can variable region V L The sequence and the sequence of 4C1 were connected by a 45bp linker, and spliced ​​to obtain a single-chain antibody 4C1V with a size of 786bp H -2D3V L . The nucleotide sequence of the linker is as follows: GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG (SEQ ID No. 7).

[0052] The corresponding amino acid sequence is as follows: GGGGSGGGGSGGGGS (SEQ ID No. 4).

[0053] scFv 4C1V H -2D3V L的核苷酸测序结果如下:CAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGCGTCTCTCCTGTGCAGCCTCCGGATATATCTTTAGCTATT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a single-domain antibody specifically bound with insect BBMV, a recombinant antibody, a coding gene and a preparation method and application, and belongs to the field of gene engineering and pest control, the amino acid sequence of the single-domain antibody is shown as SEQ ID No.1, the recombinant antibody with a synergistic effect on Bt toxin comprises the single-domain antibody, a connecting peptide and an antibody light chain variable region for recognizing the Bt toxin which are connected in sequence, the recombinant antibody provided by the invention has high specific binding activity with plutella xylostella BBMV and four Bt toxins, can improve the fatality rate of the four toxins to plutella xylostella larvae from 23.3-38.3% to 63.3-88.3%, and has a remarkable synergistic effect on the Bt toxins; the application of the recombinant antibody can effectively improve the pest control effect of a Bt preparation or Bt crops, and effectively delay the evolution of target pest Bt resistance.

Description

technical field [0001] The invention belongs to the field of genetic engineering and pest control, and in particular relates to a single-domain antibody specifically binding to insect BBMV, a recombinant antibody, a coding gene, a preparation method and an application. Background technique [0002] Bacillus thuringiensis (Bt) is one of the most successful biopesticides currently applied. The insect-resistant crops produced by stably expressing the Bt insecticidal gene into plants through transgenic biotechnology have opened a new era of Bt application. chapter. Since its promotion and use in 1996, farmers have planted more than 930 million hectares of this genetically modified crop, effectively suppressing the population of target pests, reducing dependence on conventional pesticides, and increasing farmers' income. However, long-term intensive cultivation of Bt crops puts enormous selection pressure on target pests and leads to the evolution of their resistance. Given tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/18C12N15/13C07K16/46A01N37/46A01P7/04
CPCC07K16/18C07K16/1278A01N37/46C07K2317/569C07K2317/31C07K2317/56Y02A50/30
Inventor 刘贤金高美静卢莉娜胡晓丹仲建锋张霄徐重新谢雅晶朱庆林曼曼陈蔚
Owner JIANGSU ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap