Porcine encephalomyocarditis indirect ELISA diagnosis kit and preparation method thereof
A diagnostic kit and myocarditis technology, applied in the field of porcine encephalomyocarditis indirect ELISA diagnostic kit and its preparation, can solve the problems of low sensitivity and specificity, high price, cumbersome operation, etc., and achieve easy purification, low cost, highly specific effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1 Porcine encephalomyocarditis indirect ELISA diagnostic kit
[0038] This embodiment provides a preparation method of an indirect ELISA diagnostic kit for porcine encephalomyocarditis and the specificity experimental results of the ELISA diagnostic kit.
[0039] 1. Cloning of encephalomyocarditis virus 2A gene and construction of prokaryotic expression vector
[0040] Refer to JQ864080 in GenBank to design specific primers for the 2A gene fragment,
[0041] Upstream primer: CGGGATCCAGTCCAAATGCCCTAGACAT (SEQ ID NO.1);
[0042] Downstream primer: CGCTCGAGttaTTGGGTCTGGAAAACCTGTT (SEQ ID NO.2);
[0043] A 2A-specific target gene (as shown in SEQ ID NO.3) with a size of 471bp was obtained by PCR amplification,
[0044]AGTCCAAATGCCCTAGACATTTCAAGAACATACCCCACGTTACATGTTCTCATTCAATTCAACCATAGAGGTTTGGAGGTTAGATTGTTTAGACATGGACAATTTTGGGCTGAAACACGTGCGGACGTGATTCTGAGATCGAAGACCAAACAGGTCTCTTTCCTGAGCAACGGGAACTACCCGTCAATGGACTCTAGAGCTCCCTGGAATCCTTGGAAGAATACCTACCAGGCGGTTCTAAGAGCA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



