A method for detecting tacrolimus precision medicine, primers, PCR reagents and kits
A precision medicine, tacrolimus technology, applied in the field of medical treatment and biological detection, can solve the problems of increasing CYP3A4 enzyme activity, accelerating tacrolimus metabolism, affecting blood drug concentration, etc., so as to improve the positive rate of detection and reduce the clinical The effect of detection cost and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Example 1: Design and optimization of primers, and establishment of reaction system
[0079] Through the primer design software on the PharmGKB website, adjust the relevant parameters, complete the PCR amplification and extension primer design of the three SNP sites, export the designed primers and various parameter files, and synthesize the primers. Prepare the amplification primer MIX and the extension primer MIX according to the primer configuration table, and fine-tune the extension primer MIX until it meets the requirements. Primer testing and optimization were then performed. Specific steps are as follows:
[0080] 1. Using the whole blood of patient A with EDTA anticoagulant as a template, the genome was extracted;
[0081] First, add 200 μL of cell lysate to 1 mL of whole blood, centrifuge and pour off the supernatant; add 200 μL of isopropanol to the precipitate to extract nucleic acid, centrifuge and pour off the supernatant; add 200 μL proteinase K to the...
Embodiment 2
[0118] Example 2: Detection of tacrolimus dosage regimen based on genetic polymorphisms analyzed by MALDI-TOF mass spectrometry platform Test method applied to clinical case
[0119] Patient A suffered from immune rejection after liver transplantation. Based on the MALDI-TOF nucleic acid mass spectrometry platform, the detection method of tacrolimus metabolism-related genotyping can detect the hotspot mutation sites related to tacrolimus metabolism in patient A. Site variation information guides patients to rationally use drugs, including the following steps:
[0120] One, design the amplification primer shown in table 8, the extension primer shown in table 9 and the standard product nucleic acid sequence shown in table 10;
[0121] Table 8 Amplification primers of target gene sequence
[0122]
[0123]
[0124] Table 9 Extension primers for the target gene sequence
[0125] target gene sequence extension primer rs2032582 TTAGTTTGACTCACCTTCCCAG (S...
Embodiment 3
[0145] The verification of embodiment 3 reaction system
[0146] During the system optimization process of this example, 2 to 3 samples of each detection site were verified by Sanger sequencing, and the comparison results were all consistent, confirming that the detection results of this example are accurate. In this embodiment, after confirming the optimal reaction system, a series of verification experiments were carried out, including accuracy and precision. The specific verification scheme is as follows:
[0147] (1) Accuracy experimental verification plan: select one sample for each of the three SNP sites for Sanger sequencing, and compare the results of Sanger sequencing and MassARRAY. If the consistency is greater than 95%, the verification is passed.
[0148] (2) Precision experiment verification plan: pick 3 peripheral blood samples and 3 corresponding oral swab samples, repeat 3 times for each sample to conduct a batch of detection, a total of 3 batches were detec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More