Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of LINC00167 in preparation of medicine for inhibiting tumor angiogenesis

A technology of tumor angiogenesis and drugs, applied in the field of biomedicine, can solve problems such as the negative impact on the prognosis of radiotherapy patients, the intensification of tumor blood vessels, etc., and achieve the effect of reducing the chance of recurrence and improving the prognosis

Active Publication Date: 2021-06-22
SUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, during conventional photon radiotherapy (XRT), tumor angiogenesis is exacerbated after radiotherapy, which promotes distant metastasis and recurrence of tumors, which has a negative impact on the prognosis of radiotherapy patients.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of LINC00167 in preparation of medicine for inhibiting tumor angiogenesis
  • Application of LINC00167 in preparation of medicine for inhibiting tumor angiogenesis
  • Application of LINC00167 in preparation of medicine for inhibiting tumor angiogenesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] (1) The present invention screened out a long-chain non-coding RNA whose expression was upregulated after irradiation: LINC00167 through biological experiment technology, and its nucleotide sequence is as follows:

[0030]attttgggtgggactaagcaaagacgaaacaccctcccagtctatggggtagtctggaccctggcttatctggttcccttaatcctttaggtacttacacgacgttgggtgaggggagctggaagatcagcgggtccccgatcctctctccctaggggtgatagaaatcaaccccccccgccacctccaggtggttcttcccgccgcagagtgggagcagcataaaaggcggggtcttattagcataatctgcctggcaacctgatctcgacgttatatgattggttaaactctgtaagccccatgccgtgcctagagacgagaaacgctggggcgaactgacaggcccagatttaggagtcatgacgaagatcctgagacgcttattcagtctgcagagaagccaaaaggagattcacataatggcccaatgactgaaggcctctttatttcgtgctctgctgttcgtgtaaaacccaatcgcagagcgggtctcaggcggcgctcgcctgcgtttctactctcagccaatcagaaaacccgactcttcgcattggggtcaagcccccgctgcggcccgcgtgctaacggggaggaagcttccagctgtgcctgggtgtctcgggcgccgagggcagcctgcgcccgtgctaagcccgcctcccgcgcgcccgagggcccggtgtcccggaagacgcgcgggggtgaggcggccctcgcgtccgcccgccccgccacagattgcctccgaagtggcctggccgt...

Embodiment 2

[0034] Example 2 The Effect of Irradiation on the Expression of LINC00167

[0035] (1) Cell culture

[0036] The stable lung cancer cell line A549 cells were selected and cultured with RPMI-1640 complete medium at a constant temperature of 37°C and 5% CO 2 Cultured in a cell incubator; wash the cells with sterile PBS 2-3 times, and then digest with 0.25% trypsin for 1-2min. Resuspend the RPMI-1640 complete medium; divide into new culture dishes, add RPMI-1640 complete medium for expanded culture.

[0037] (2) Irradiation treatment

[0038] The cultured A549 cells were divided into control group and experimental group, each group had about 1×10 8 Cells; the ionizing radiation experiment was carried out with an electric energy excited X-ray irradiator (model RAD SOURCE, RS-2000) for biological experiments, the voltage was 50KV, the dose rate was 1.224Gy / min, and the experimental group received 2Gy X-rays Irradiated, the control group was not irradiated; after irradiation, th...

Embodiment 3

[0049] Example 3 Angiogenesis Experiment

[0050] A549 cells were cultured in 6-well plates. When they grew to 60%-70% confluence, they were irradiated with X-rays at a dose of 2Gy. 2 After culturing for 24 hours under conditioned conditions, the culture medium of A549 cells was taken to culture HUVEC cells, and the influence of the conditioned medium of the irradiation group and the non-irradiation group on the angiogenesis level of HUVEC cells was observed.

[0051] The day before the experiment, Matrigel (Corning 354234-9148009) was melted at 4°C. Sterilized 200μL pipette tips, 1mL pipette tips and 96-well plates were refrigerated for later use. At the beginning of the experiment, keep Matrigel on ice or in an ice box to ensure that the concentration of Matrigel is greater than or equal to 10mg / mL, spread evenly in a pre-cooled 96-well plate, 100 μL per well. Put the whole Petri dish into the incubator and let it stand for 30min to make the gel solidify. While waiting fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of LINC00167 in preparation of a medicine for inhibiting tumor angiogenesis, and belongs to the technical field of biological medicine. The LINC00167 is an lncRNA closely related to ionizing radiation stimulation, the expression level of the LINC00167 is remarkably increased after X-ray irradiation, and the expression level is higher and higher along with the prolonging of the time after irradiation. Meanwhile, the expression level of the LINC00167 is positively correlated with the tumor angiogenesis level, which means that the LINC00167 can play a key role in the response process of the tumor to radiation stimulation; by utilizing the point, the high expression of the LINC00167 after irradiation can be artificially inhibited, so that the same effect as that of a clinically common vascular inhibitor is achieved, the prognosis of tumor patients after radiotherapy is improved, and the recurrence probability of tumors is reduced.

Description

technical field [0001] The present invention relates to the technical field of biomedicine, and more specifically relates to the application of LINC00167 in the preparation of drugs for inhibiting tumor angiogenesis. Background technique [0002] Long non-coding RNA (Long no-coding RNA, lncRNA) is a kind of RNA fragment without protein coding function, its length is generally greater than 200 nucleotides, widely exists in the human genome, and accounts for the total human genome 98%, that is to say, only about 2% of the RNA in the human genome has protein coding functions; therefore, lncRNA was once considered a "junk gene" by scientists. In recent years, with the deepening of research, scientists have discovered that although lncRNA cannot encode proteins, it can exert biological functions by binding to DNA or RNA, or even binding to proteins, forming a fine and complex biological regulatory network. At present, research in the field of biology has proved that lncRNA is in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7088A61P35/00
CPCA61K31/7088A61P35/00
Inventor 周光明黄皓胡文涛
Owner SUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More