Application of LINC00167 in preparation of medicine for inhibiting tumor angiogenesis
A technology of tumor angiogenesis and drugs, applied in the field of biomedicine, can solve problems such as the negative impact on the prognosis of radiotherapy patients, the intensification of tumor blood vessels, etc., and achieve the effect of reducing the chance of recurrence and improving the prognosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] (1) The present invention screened out a long-chain non-coding RNA whose expression was upregulated after irradiation: LINC00167 through biological experiment technology, and its nucleotide sequence is as follows:
[0030]attttgggtgggactaagcaaagacgaaacaccctcccagtctatggggtagtctggaccctggcttatctggttcccttaatcctttaggtacttacacgacgttgggtgaggggagctggaagatcagcgggtccccgatcctctctccctaggggtgatagaaatcaaccccccccgccacctccaggtggttcttcccgccgcagagtgggagcagcataaaaggcggggtcttattagcataatctgcctggcaacctgatctcgacgttatatgattggttaaactctgtaagccccatgccgtgcctagagacgagaaacgctggggcgaactgacaggcccagatttaggagtcatgacgaagatcctgagacgcttattcagtctgcagagaagccaaaaggagattcacataatggcccaatgactgaaggcctctttatttcgtgctctgctgttcgtgtaaaacccaatcgcagagcgggtctcaggcggcgctcgcctgcgtttctactctcagccaatcagaaaacccgactcttcgcattggggtcaagcccccgctgcggcccgcgtgctaacggggaggaagcttccagctgtgcctgggtgtctcgggcgccgagggcagcctgcgcccgtgctaagcccgcctcccgcgcgcccgagggcccggtgtcccggaagacgcgcgggggtgaggcggccctcgcgtccgcccgccccgccacagattgcctccgaagtggcctggccgt...
Embodiment 2
[0034] Example 2 The Effect of Irradiation on the Expression of LINC00167
[0035] (1) Cell culture
[0036] The stable lung cancer cell line A549 cells were selected and cultured with RPMI-1640 complete medium at a constant temperature of 37°C and 5% CO 2 Cultured in a cell incubator; wash the cells with sterile PBS 2-3 times, and then digest with 0.25% trypsin for 1-2min. Resuspend the RPMI-1640 complete medium; divide into new culture dishes, add RPMI-1640 complete medium for expanded culture.
[0037] (2) Irradiation treatment
[0038] The cultured A549 cells were divided into control group and experimental group, each group had about 1×10 8 Cells; the ionizing radiation experiment was carried out with an electric energy excited X-ray irradiator (model RAD SOURCE, RS-2000) for biological experiments, the voltage was 50KV, the dose rate was 1.224Gy / min, and the experimental group received 2Gy X-rays Irradiated, the control group was not irradiated; after irradiation, th...
Embodiment 3
[0049] Example 3 Angiogenesis Experiment
[0050] A549 cells were cultured in 6-well plates. When they grew to 60%-70% confluence, they were irradiated with X-rays at a dose of 2Gy. 2 After culturing for 24 hours under conditioned conditions, the culture medium of A549 cells was taken to culture HUVEC cells, and the influence of the conditioned medium of the irradiation group and the non-irradiation group on the angiogenesis level of HUVEC cells was observed.
[0051] The day before the experiment, Matrigel (Corning 354234-9148009) was melted at 4°C. Sterilized 200μL pipette tips, 1mL pipette tips and 96-well plates were refrigerated for later use. At the beginning of the experiment, keep Matrigel on ice or in an ice box to ensure that the concentration of Matrigel is greater than or equal to 10mg / mL, spread evenly in a pre-cooled 96-well plate, 100 μL per well. Put the whole Petri dish into the incubator and let it stand for 30min to make the gel solidify. While waiting fo...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap