Research method of exosome PD-L1

A PD-L1 and exosome technology, applied in the research field of exosome PD-L1, can solve the problem of unpredictable immunotherapy response of patients, and achieve the effect of maintaining integrity and function, small molecular weight, and simple operation.

Active Publication Date: 2021-08-06
XIAMEN UNIV
View PDF14 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The above research methods detect all exoPD-L1 in body fluids, but clinical studies have shown that the level of exoPD-L1 is inconsistent with the basic pathological conditions of tumor patients, and there are false positives and false negatives in differentiating tumor patients and healthy people based on exoPD-L1 levels. And the level of exoPD-L1 cannot predict the immunotherapy response of some patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Research method of exosome PD-L1
  • Research method of exosome PD-L1
  • Research method of exosome PD-L1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] 1. The principle of exosomal PD-L1 glycosylation detection

[0040] A375 cells (melanoma) and azide-modified sialic acid metabolism substrate Ac 4 ManNAz culture, the cells metabolize sugar to the surface of the cell membrane to form sialic acid, and then excrete exosomes through endocytosis, so that the azide-modified sialic acid is labeled on the surface of the exosomes, and then mixed with DBCO-Cy5 alkynyl dye (dissolved in DMSO) for copper-free bioorthogonal reaction labeling sugar chains. Use Cy3-labeled PD-L1 aptamer (TACAGGTTCTGGGGGGTGGGTGGGGAACCTGTT) to recognize PD-L1 protein on the surface of exosomes, and achieve specific PD-L1 glycosylation detection through fluorescence resonance energy transfer (FRET) between Cy3 and Cy5 (add The exosomes of A375 cells cultured with the same amount of DMSO were used as the control group).

[0041] (1) Cell culture. A375 cells (melanoma) were digested and resuspended in DMEM medium containing 1% FBS and 1% double antibod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
particle sizeaaaaaaaaaa
Login to view more

Abstract

The invention discloses a research method of an exosome PD-L1. The method comprises the steps of 1) co-culturing cells and non-natural sugar, and secreting the exosome containing the non-natural sugar from the cells; (2) marking a functional probe on the non-natural sugar, wherein the functional probe is provided with a first mark; (3) identifying protein on the surface of the exosome by using an aptamer, wherein the aptamer is provided with a second marker; and 4) enabling the first marker to interact with the second marker, and detecting the interaction effect, so that the glycosylation information of the exosome protein is detected. According to the method, the glycosylation of the exosome PD-L1 can be detected in situ, the operation is simple, invasive operations such as cell lysis are not needed, and the integrity and functions of the cells are kept.

Description

technical field [0001] The invention relates to a research method of exosome PD-L1. Background technique [0002] Exosomal programmed death ligand 1 (exoPD-L1) binds to programmed cell death protein 1 (PD-1) on the surface of T lymphocytes, inhibits the proliferation, cytokine production and cytotoxicity of T lymphocytes, thereby suppressing immune answer. Investigating the mechanisms of exoPD-L1-induced immunosuppression and discovering more accurate exoPD-L1-induced immune prediction targets is important for understanding its importance as a biomarker of immunosuppression and its potential as a biomarker for predicting response to immunotherapy significance. [0003] In prior art: [0004] CN201910145354.8 discloses an in vitro rapid detection platform and detection method for PDL1 exosomes. The detection platform includes a sample primary filtration area, a nanofiltration area, a chromogenic material pad area, a chromogenic area, and a water-absorbent pad area. At lea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68
CPCG01N33/68
Inventor 杨朝勇朱琳许元风林颢霆林冰倩宋彦龄
Owner XIAMEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap