Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting cotton bollworm based on terrestrial environment DNA and application thereof

A cotton bollworm and a kit technology, applied in the field of agricultural biology, can solve the problems of poor timeliness, single detection object, difficult to obtain, etc., and achieve the effects of high specificity and extended application range.

Pending Publication Date: 2021-08-10
HUNAN UNIV OF SCI & TECH
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The environmental DNA of terrestrial pests is not only difficult to obtain, but also easy to decompose, so the technology of detecting pests based on environmental DNA has not been developed yet
In addition, the previously developed technology is to detect a single species, because environmental DNA is difficult to extract and separate, but the present invention needs to overcome and improve the existing technology to realize multi-species detection
[0014] Most of the existing terrestrial agricultural pest detection technologies need to judge the insect body itself, and it is difficult to rule out the influence of many external interference factors in the identification and monitoring process, so that technicians cannot make very objective judgments
And a single detection object is single, time-sensitive, time-consuming and labor-intensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting cotton bollworm based on terrestrial environment DNA and application thereof
  • Kit for detecting cotton bollworm based on terrestrial environment DNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] A kit for detecting cotton bollworm based on terrestrial environment DNA, including primer pairs and Taqman fluorescent probes designed according to the specific segment of the genome of the target pest cotton bollworm;

[0045] The specific DNA sequence is shown in SEQ ID NO.1, specifically 5-CCATTCCAACAGCGCTCATTCTCTCAGCAGCGAAGTCAGGTTTGTCACACACTCGATCCGCTAGTCCAGCAAAGAGTTTCTTATTCGACGCTAGGGTGGCTGCAAATAG-3

[0046] The primer pair included MLC2-F and MLC2-R.

[0047] The DNA sequence of MLC2-F is shown in SEQ ID NO.2, specifically: CCATTCCAACAGCGCTCATT.

[0048]The DNA sequence of MLC2-R is shown in SEQ ID NO.3; specifically: CTATTTGCAGCCACCCTAGC.

[0049] The DNA sequence of the Taqman fluorescent probe is shown in SEQ ID NO.4, specifically: AGCGAAGTCAGGTTTGTCACACACTCGAT.

Embodiment 2

[0051] A method for the kit of embodiment 1 in detecting the content of cotton bollworm in the terrestrial environment, specifically:

[0052] (1) Establish a standard curve for cotton bollworm:

[0053] 1.1. Use the TSINGKE Animal Genomic DNA Kit to extract the genomic DNA of cotton bollworm adults two days after eclosion, 50 μL, and the detection initial concentration is 426.6 ng / μL.

[0054] 1.2. Use deionized water to dilute the genomic DNA of the cotton bollworm into 10-fold gradients -1 、10 -2 、10 -3 、10 -4 times liquid. The stock solution and the above dilution were used as standard sample templates for Real-time qPCR reactions. Two sets of biological replicates were performed. Reaction system and reaction program: The total volume of reaction solution is 20 microliters, including 10 microliters of Fast qPCR Mix reaction solution, 0.8 microliters of upstream and downstream primers, 0.5 microliters of Taqman fluorescent probe, 1.0 microliters of DNA template and de...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting existence of cotton bollworm in a sample through environmental DNA extraction and quantitative PCR and an application method thereof. The kit comprises a polycarbonate corrosion filter membrane, an alkaline dissolving solution, a quantitative PCR reaction solution, a cotton bollworm specific primer pair and a Taqman fluorescent probe. During use, a fruit and vegetable sample to be detected is cleaned, environmental DNA in a washing solution is enriched by using a filter membrane, and the environmental DNA is recovered by using an alkaline dissolving solution; after being subjected to column purification, the environmental DNA is added into quantitative PCR reaction liquid as a template, a primer pair and a probe are added, and the environmental DNA and a control group without the template are subjected to quantitative PCR reaction in parallel; and the existence and relative content of the cotton bollworm DNA in the sample are judged by comparing the difference between the Cq values of the to-be-detected sample and the control group in the reaction. According to the kit, whether the pest exists in the fruits and vegetables or not can be detected when the body of the cotton bollworm is not observed so that the detection capability and efficiency are improved.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to a kit for detecting cotton bollworms based on terrestrial environment DNA and an application thereof. Background technique [0002] At present, qualitative detection is mostly used in the detection technology of terrestrial pests, which needs to obtain the insect body itself, and has the disadvantages of low accuracy and easily disturbed measurement results. In the present invention, we quantitatively detect the DNA of pests remaining in the environment, Thus, more accurate results can be obtained. Since the DNA of each organism will have its own specific sequence, we only need to find the specific sequence unique to each pest, and make fluorescent probes according to this sequence. Combine the specific fluorescent probe with the environmental DNA we obtained and amplify it, and use qPCR quantitative detection to preliminarily judge the pest category according to the sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6851C12Q1/686C12N15/11
CPCC12Q1/6888C12Q1/6851C12Q1/686C12Q2531/113C12Q2561/101C12Q2545/114Y02A50/30
Inventor 张翼飞刘雨芳王浩洋欧雪儿许铭元陈倩玉
Owner HUNAN UNIV OF SCI & TECH