Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

88 results about "Species detection" patented technology

Methods and apparatus for molecular species detection, inspection and classification using ultraviolet to near infrared Enhanced Photoemission Spectroscopy

The invention relates generally to the field of substance and material detection, inspection, and classification at wavelengths between approximately 200 nm and approximately 1800 nm. In particular, a handheld Enhanced Photoemission Spectroscopy (“EPS”) detection system with a high degree of specificity and accuracy, capable of use at small and substantial standoff distances (e.g., greater than 12 inches) is utilized to identify specific substances (e.g., controlled substances, illegal drugs and explosives, and other substances of which trace detection would be of benefit) and mixtures thereof in order to provide information to officials for identification purposes and assists in determinations related to the legality, hazardous nature and / or disposition decision of such substance(s).
Owner:CDEX

Consumable cartridge for image forming apparatus and image forming apparatus

A toner cartridge for a printer includes a species detection key which forms a part of an outer shape of the cartridge and an IC chip which stores individual information, wherein a part of a harness for connecting to the IC chip or between the IC chip and a connector portion is mounted on the species detection key. A main body of the printer has a key receiving portion which mates with the species detection key. Thereby, the printer can detect erroneous attachment of a cartridge at early stage and surely cope with various types of cartridges requiring only compact space with the aid of its detection means.
Owner:KONICA MINOLTA BUSINESS TECH INC

Method and Apparatus for the Detection of Trace Gas Species Using Multiple Line Integrated Absorption Spectroscopy

An apparatus and method are used to enhance the sensitivity of a spectrometer (sensor) for trace gas species detection by employing an external cavity continuously tunable CW quantum cascade laser and integrating the absorption spectra across multiple lines of the species. With this method the absorption spectra of NO2 is continuously recorded across the R-branch from 1628.8 cm−1 to 1634.5 cm−1. By integrating the resulting spectra, the detection sensitivity for NO2 is improved by a factor of 15 compared to the sensitivity achieved using single line laser absorption spectroscopy with the same apparatus. This procedure offers much shorter data acquisition times for the real-time monitoring of trace gas species compared with adding repeated scans of the spectra to improve the signal-to-noise ratio.
Owner:ADELPHI UNIVERSITY

System and method for trace species detection using cavity attenuated phase shift spectroscopy with an incoherent light source

ActiveUS7301639B1Maximise couplingStable light outputColor/spectral properties measurementsBroadband absorptionSpectroscopy
This invention provides a system and method that enables the use of incoherent light sources, such as light emitting diodes, to provide for the detection of gaseous species which exhibit broadband absorption features (e.g., nitrogen dioxide and the halogen gases). The light emitting diode (LED) is an ideal light source for such an arrangement in that it can be modulated at high frequencies (allowing for omission of external modulation equipment) and provides sufficient illumination within a reasonably narrow wavelength band as compared to, for instance, an incandescent light source. A further advantage of a LED as a light source compared to alternatives such as a gas discharge or arc lamp is that the light output of the LED is highly stable, limited by the stability of the current source used to drive it. Use of a confocal or near-confocal resonant optical cavity maximizes coupling of the light source to the cavity.
Owner:AERODYNE RES

Apparatus and systems for processing samples for analysis via ion mobility spectrometry

The invention provides an interface assembly for delivering an ionized analyte from an ionization apparatus into an ion mobility spectrometer. This allows analysis of biological and non-biological samples, even non-volatile solids, via differential mobility spectrometry, without fragmentation of molecules. The invention also provides portable sample analysis systems that operate at ambient pressure. Systems of the invention may be used for high molecular weight species detection, for example, drinking water contaminants, pathogenic biological agents, bio-organic substances, non-biological material, peptides, proteins, oligonucleotides, polymers, bacteria, and hydrocarbons.
Owner:CHARLES STARK DRAPER LABORATORY

Cyanide and related species detection with metal surfaces

An assay method and kit for detecting a chemical. The method and kit utilize a metal surface capable of surface enhanced Raman Scattering. The metal surface may be provided in the form of one or more nanoparticles, to increase the surface enhanced Raman Scattering capability of the metal surface. The nanoparticles may be treated with one or more additives to further enhance or maintain the surface enhanced Raman Scattering capability of the nanoparticles.
Owner:UNIVERSITY OF WYOMING

Unmanned machine-based wild animal community condition monitoring method

The invention discloses an unmanned machine-based wild animal community condition monitoring method. The unmanned machine-based wild animal community condition monitoring method not only can monitor the distribution and growth conditions of wild animal community, but also can track and monitor endangered and critically endangered animals and alien species, can take the spotlight in the field of wild animal resource protection, achieve favorable effects in the fields of investigation and evidence collection, prewarning and frightening, collaborative tracking and the like by full verification at the early-stage testing step, prevents limits of original manual patrol, lowers the cost of monitoring and patrol equipment greatly, and has the characteristics of wide monitoring range, species detection diversity, rapid and timely resource supply and the like.
Owner:恒创数字科技(江苏)有限公司

LIBS system and method for engine exhaust monitoring

A trace species detection system for engine health monitoring, the system including a laser for generating a laser beam, and optics for focusing the laser beam into an exhaust plume of an engine for thereby creating a spark in the exhaust plume. The system further includes spectral analysis instrumentation for detecting light emissions from the spark, and statistical processing instrumentation for analyzing data from the spectral analysis instrumentation for thereby identifying and quantifying specific particles within a volume of the spark. The invention also provides a method of monitoring the health of an engine, the method including generating a laser beam, focusing the laser beam into an exhaust plume of the engine for thereby creating a spark in the exhaust plume, detecting light emissions from the spark, and analyzing data from the detection for thereby identifying and quantifying specific particles within a volume of the spark.
Owner:WEATHERFORD TECH HLDG LLC

Apparatus and systems for processing samples for analysis via ion mobility spectrometry

The invention provides an interface assembly for delivering an ionized analyte from an ionization apparatus into an ion mobility spectrometer. This allows analysis of biological and non-biological samples, even non-volatile solids, via differential mobility spectrometry, without fragmentation of molecules. The invention also provides portable sample analysis systems that operate at ambient pressure. Systems of the invention may be used for high molecular weight species detection, for example, drinking water contaminants, pathogenic biological agents, bio-organic substances, non-biological material, peptides, proteins, oligonucleotides, polymers, bacteria, and hydrocarbons.
Owner:CHARLES STARK DRAPER LABORATORY

Animal species distinguishing method and device

ActiveCN107532196AEasy to identify accuratelyThe effect of correctly implementing the quality indicationConnective tissue peptidesMicrobiological testing/measurementBiotechnologyAmino acid
[Problem] To provide an objective method and a device for distinguishing animal species by identifying animal species through peptide analysis. [Solution] This method is provided with: a step for, byusing a proteolytic enzyme (protease), cleaving, into peptide fragments, a group of animal fibrous proteins (collagen, etc.) extracted from a distinguishing-subject sample, and analyzing the peptide fragments through amino acid sequencing; a step for removing, from all the analyzed peptide fragments, peptide fragments commonly detected in all animal species to be distinguished, and selecting peptide fragments that are specifically detected in at least one animal species; and a step for distinguishing the animal species of the sample by using the selected peptide fragments. Among the selected peptide fragments, a peptide fragment detected specifically in one particular animal species is used first for distinguishing the animal species of the sample, and, with respect to a sample with whichdistinguishing was unsuccessful, a peptide fragment detected specifically in at least two animal species is used next for distinguishing the animal species.
Owner:KOBE UNIV +1

Gas detector for atmospheric species detection

A gas detector includes a receiver configured to receive light from a light source through gas, the light source having a bandwidth on the order of an absorption linewidth of the gas, the receiver including at least a first etalon having a transmission bandwidth on the order of the absorption linewidth of the gas, the transmission bandwidth of the first etalon being substantially smaller than the bandwidth of the light source. The gas detector further includes a first detector for detecting light transmitted through the first etalon, a second detector for detecting light reflected from the first etalon, and a processor that determines the quantity of gas based on the detected transmitted and reflected light. The gas detector can further include a second etalon with a transmission bandwidth approximately equal and adjacent to the transmission bandwidth of the first etalon. Alternatively, the gas detector can include a beam separator that separates the light from the light source into a first beam and a second beam, with a small deflection angle between the first beam and the second beam, thereby modifying the effective thickness of a single optical element for each beam and forming the first and second etalon in the optical element.
Owner:MASSACHUSETTS INST OF TECH

LIBS system and method for engine exhaust monitoring

A trace species detection system for engine health monitoring, the system including a laser for generating a laser beam, and optics for focusing the laser beam into an exhaust plume of an engine for thereby creating a spark in the exhaust plume. The system further includes spectral analysis instrumentation for detecting light emissions from the spark, and statistical processing instrumentation for analyzing data from the spectral analysis instrumentation for thereby identifying and quantifying specific particles within a volume of the spark. The invention also provides a method of monitoring the health of an engine, the method including generating a laser beam, focusing the laser beam into an exhaust plume of the engine for thereby creating a spark in the exhaust plume, detecting light emissions from the spark, and analyzing data from the detection for thereby identifying and quantifying specific particles within a volume of the spark.
Owner:WEATHERFORD TECH HLDG LLC

Brown tide algae species detection method and kit

The invention relates to a brown tide algae species detection method which comprises the following steps: 1) designing and synthesizing specific primers AanF and AanR and an Aan probe, wherein the sequence of the AanF is AAAGCTCGTAGTTGGATTCCTGG; the sequence of the AanR is GTGTTCAACGCACGCTTACG; the sequence of the Aan probe is CTTGCGATGGTCTATCCT; 2) selecting a standard algal strain and constructing a recombinant plasmid standard; 3) constructing a standard curve; 4) verifying the specificities of the primers AanF and AanR and the Aan probe; 5) performing sample detection and result analysis. The detection method provided by the invention can be used for qualitative and quantitative detection of a brown tide algae species and has the advantages of high sensitivity, good reproducibility, continuous measurement, good convenience and high simplicity in operation, high easiness in control, short analysis time and the like.
Owner:CHINESE RES ACAD OF ENVIRONMENTAL SCI

Gas detector for atmospheric species detection

A gas detector includes a receiver configured to receive light from a light source through gas, the light source having a bandwidth on the order of an absorption linewidth of the gas, the receiver including at least a first etalon having a transmission bandwidth on the order of the absorption linewidth of the gas, the transmission bandwidth of the first etalon being substantially smaller than the bandwidth of the light source. The gas detector further includes a first detector for detecting light transmitted through the first etalon, a second detector for detecting light reflected from the first etalon, and a processor that determines the quantity of gas based on the detected transmitted and reflected light. The gas detector can further include a second etalon with a transmission bandwidth approximately equal and adjacent to the transmission bandwidth of the first etalon. Alternatively, the gas detector can include a beam separator that separates the light from the light source into a first beam and a second beam, with a small deflection angle between the first beam and the second beam, thereby modifying the effective thickness of a single optical element for each beam and forming the first and second etalon in the optical element.
Owner:MASSACHUSETTS INST OF TECH

Rapid response sensor for carbon monoxide

InactiveUS20070166585A1High precisionMitigation and graceful degradationWeather/light/corrosion resistanceVolume/mass flow measurementFinite-state machineCO poisoning
Species detection techniques are described based on measurement of a dynamic response to an external stimulus. One embodiment includes a voltage stimulus applied to a polymer electrolyte fuel cell (PEFC), with the response to said stimulus used to measure CO concentration on the anode catalyst. The principles of symbolic dynamics, finite state machines or a simplified peak response-to-asymptotic value measurement can be used to achieve a high degree of precision for measuring CO concentrations. Using the techniques of the present invention, CO poisoning of a fuel cell can be monitored and diagnosed before reaching a critical condition, thereby allowing early implementation of mitigation or graceful degradation strategies.
Owner:PENN STATE RES FOUND

A method for detecting peripheral blood gpc3 in patients with hepatocellular carcinoma

The invention discloses a peripheral blood GPC3 detection method for a hepatocellular carcinoma patient. CTC in peripheral blood, where a tissue specimen can not be obtained, of the hepatocellular carcinoma patient is separated and obtained through a membrane filter device, a thin-layer slice is manufactured through the cell wax block technology, and the GPC3 expression situation is detected. By means of the technical method, the GPC3 expression situation in the peripheral blood of the hepatocellular carcinoma patient can be detected without taking hepatocellular carcinoma tissue, and the foundation is provided for hepatocellular carcinoma diagnosis. The technology is minimally invasive and even non-invasive, and real-time detection can be conducted.
Owner:山东祺欣生物科技有限公司

Cyanide and related species detection with metal surfaces

An assay method and kit for detecting a chemical. The method and kit utilize a metal surface capable of surface enhanced Raman Scattering. The metal surface may be provided in the form of one or more nanoparticles, to increase the surface enhanced Raman Scattering capability of the metal surface. The nanoparticles may be treated with one or more additives to further enhance or maintain the surface enhanced Raman Scattering capability of the nanoparticles.
Owner:UNIVERSITY OF WYOMING

Species Detection Using Mass Spectrometry

Systems and methods are provided for species detection using mass spectrometry. In various embodiments, a multiple reaction monitoring (MRM) experiment is performed on a sample targeting one or more peptide transitions that are unique to one or more species using a tandem mass spectrometer. One or more measured product ion spectra are received from the tandem mass spectrometer using the processor. The one or more measured product ion spectra are compared to product ions of the one or more peptide transitions that are unique to one or more species using the processor. One or more species of the sample are detected by reporting product ions of the one or more peptide transitions that are unique to one or more species that match the one or more measured product ion spectra using the processor.
Owner:DH TECH DEVMENT PTE

System and Method for Immobilization free electrochemiluminescence DNA detection using a luminophore dye for multi-species detection

ActiveUS20180037944A1Promotes electrochemical reactionsSensitive highMicrobiological testing/measurementAmplification dnaLoop-mediated isothermal amplification
Present invention disclosed a novel method for detecting and quantifying target DNA from the biological sample. It provides a method of amplification of DNA sequences with loop-mediated isothermal amplification (LAMP) and its easy and accurate detection and quantification by electrochemiluminescence (ECL) technique. The target LAMP DNA is bound electrostatically with [Ru(bpy)3]+2 on the carbon electrode surface, and an ECL reaction is triggered by tripropylamine (TPrA) to yield luminescence. This is a highly sensitive strategy for the detection of sequence-specific DNA from different biological samples at picogram levels. The target DNA of Sus scrofa (pork) meat was detected as low as 1 pg / μL (3.43×10−1 copies / μL) and for Bacillus subtilis DNA samples the detection limit of 10 pg / μL (2.2×103 copies / μL) was achieved.
Owner:UNIVERSITI BRUNEI DARUSSALAM

Ruditapes philippinarum species real-time fluorescent PCR (polymerase chain reaction) specific detection system and application thereof

The invention belongs to the technical field of biology, and particularly relates to a Ruditapes philippinarum species real-time fluorescent PCR (polymerase chain reaction) specific detection system and application thereof. The sequences of the primers and probe are as follows: 5'-ggttgaacagtctaccctcc-3' (forward); 5'-gctaacatactactacgcaaaa-3' (reverse); and 5'-tctcttcacgtaggtggtgtctcttcaatt-3' (probe). After the Ruditapes philippinarum species specific detection primers and probe are adopted to perform real-time fluorescent PCR amplification on CoxI gene of Ruditapes philippinarum, a specific amplification curve can be generated, thereby performing specific identification on the Ruditapes philippinarum components. The specific primers and probe are reasonably designed, and have the advantages of favorable specificity and high detection sensitivity when being used for Ruditapes philippinarum species detection. The fluorescent PCR analysis can be performed to accurately identify the Ruditapes philippinarum components, thereby having favorable specificity.
Owner:刘淑艳 +3

Optimizing West Lake Longjing tea tree species detection method on basis of genetic algorithm

An optimizing West Lake Longjing tea tree species detection method on the basis of genetic algorithm is characterized in that: an electronic nose is used to collect finger prints from odors of different species of collected West lake Longjing tea; on the basis of analysis of average finger print and the score plot of the main component, by adopting three key technologies of genetic algorithm, namely the roulette wheel selection, single-point crossover, and simple mutation, and taking the overall recognition rate as the adaptability function, sensors that are contributed to the modeling of tree species are chosen to carry out optimizing combination, thus the required number of sensors for modeling is reduced, at the same time a matrix analysis is carried out for the sensor spectrum responding value through the F value of variance analysis and the main component load.
Owner:CHINA NAT INST OF STANDARDIZATION

Environmental DNA macro bar code method for researching macrobenthic animal community structure

PendingCN112359119ASimple samplingFast samplingMicrobiological testing/measurementDNA/RNA fragmentationZooidFishery
The invention discloses an environmental DNA macro bar code method for researching a macrobenthic animal community structure. One technical scheme to be protected by the invention is the application of the primer pair in detecting the community structure of the macrobenthos in the water area to be detected. The primer pair is named as COI and is composed of a primer 1 and a primer 2, and the primer 1 and the primer 2 can be a sequence 1 and a sequence 2 in a sequence table. Compared with a traditional method, the COI primer provided by the invention is used for amplifying an environmental DNAsample of a to-be-detected water area, and sequencing and annotation analysis are carried out to obtain more obvious species, especially benthonic animal groups which are easy to escape, small in sizeand partial in life history in water; and the method can supplement benthonic animal abundance data which are easy to ignore, difficult to find and small in size in a traditional investigation method, effectively improves the identification level, species detection rate and abundance evaluation accuracy of the large benthonic animals, and is an effective and reliable new method for investigatingthe community structure of the large benthonic animals.
Owner:RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI

Method and apparatus for the detection of trace gas species using multiple line integrated absorption spectroscopy

An apparatus and method are used to enhance the sensitivity of a spectrometer (sensor) for trace gas species detection by employing an external cavity continuously tunable CW quantum cascade laser and integrating the absorption spectra across multiple lines of the species. With this method the absorption spectra of NO2 is continuously recorded across the R-branch from 1628.8 cm−1 to 1634.5 cm−1. By integrating the resulting spectra, the detection sensitivity for NO2 is improved by a factor of 15 compared to the sensitivity achieved using single line laser absorption spectroscopy with the same apparatus. This procedure offers much shorter data acquisition times for the real-time monitoring of trace gas species compared with adding repeated scans of the spectra to improve the signal-to-noise ratio.
Owner:ADELPHI UNIVERSITY

Process for testing bacteria gene chip in sewage

This invention relates a gene chip detection method of bacteria in sewage. The procedures includes that selection of objective bacteria, the characteristic gene selected from different objective bacteria are used as target gene of gene detecting, PCR prime and species detecting probe are designed according to special gene of different bacteria, the gene chip is prepared according to the design. Then DNA of the bacteria is distilled, PCR amplifying reaction is done, then reactive product of the amplifying reaction is hybridized and product clearing. In this invention, the characteristic gene is used as target gene, and PCR prime and species detection probe are designed according to the characteristic gene of different bacteria, the prime designed has good specificity and good amplifying effect to bacteria, and without non-specificity amplifying. The distill method of pure bacteria is simple, and it can be done in 2 hours and gain ratio is high. The PCR amplification and crossover method are easy to realize, and the crossover detecting result is stable, so it is propitious to practical application of this technique.
Owner:SHANGHAI UNIV +1

Species detection using mass spectrometry

Systems and methods are provided for species detection using mass spectrometry. In various embodiments, a multiple reaction monitoring (MRM) experiment is performed on a sample targeting one or more peptide transitions that are unique to one or more species using a tandem mass spectrometer. One or more measured product ion spectra are received from the tandem mass spectrometer using the processor. The one or more measured product ion spectra are compared to product ions of the one or more peptide transitions that are unique to one or more species using the processor. One or more species of the sample are detected by reporting product ions of the one or more peptide transitions that are unique to one or more species that match the one or more measured product ion spectra using the processor.
Owner:DH TECH DEVMENT PTE

Consumable cartridge for image forming apparatus and image forming apparatus

A toner cartridge for a printer includes a species detection key which forms a part of an outer shape of the cartridge and an IC chip which stores individual information, wherein a part of a harness for connecting to the IC chip or between the IC chip and a connector portion is mounted on the species detection key. A main body of the printer has a key receiving portion which mates with the species detection key. Thereby, the printer can detect erroneous attachment of a cartridge at early stage and surely cope with various types of cartridges requiring only compact space with the aid of its detection means.
Owner:KONICA MINOLTA BUSINESS TECH INC

Lake alien aquatic plant species detection and invasion risk early warning system

The invention relates to the technical field of environment ecology, and more particularly relates to a lake alien aquatic plant species detection and invasion risk early warning system which comprises front-end monitoring equipment, a transmission link, a remote sensing satellite, a video camera, an unmanned aerial vehicle, an online water quality monitor and a display control terminal, wherein the front-end monitoring equipment comprises the remote sensing satellite, the video camera, the unmanned aerial vehicle and the online water quality monitor; the remote sensing satellite is connectedwith the display control terminal through the transmission line; the video camera is arranged near a lake water area and connected with the display control terminal through the transmission line; andthe online water quality monitor is arranged near the lake water area and connected with the display control terminal through the transmission line. The lake alien aquatic plant species detection andinvasion risk early warning system provided by the invention has the advantages of low cost, short period of detection and early warning, integration of multiple detection ways, high precision of detection and early warning, and high timeliness.
Owner:NANJING FORESTRY UNIV

Integrated electrokinetic devices and methods of manufacture

ActiveUS20070170062A1Fast shippingImprove response speedNanostructure manufactureSludge treatmentElectricityElectrical conductor
Devices with electrokinetic elements are disclosed as well as their method of microfabrication for use in micro-scale analysis, mixture separation and reaction. The devices consist of solid hydrophilic-matrix films that have been microfabricated into a variety of micro-scale structures. These structures include hydrophilic-matrix conductors for electrokinetic species transport and separation. They also include hydrophilic-matrix cladding containing chemical species adjacent to either an open conduit or a hydrophilic matrix conductor. Also described are other integrated microstructures consisting of hydrophilic-matrix materials such as micro-reaction zones for retaining chemical species for on-chip chemical reactions and integrated detection structures for on-chip species detection. In general, a hydrophilic matrix on a substrate functions as a conductor that is covered by an electrically insulating, preferably water permeable material.
Owner:SIEMENS HEALTHCARE DIAGNOSTICS INC

Internet-based microbial limit inspection system and method

The invention belongs to the technical field of microbial limit inspection. The invention discloses an internet-based microbial limit inspection system and method. The internet-based microbial limit inspection system comprises an environment cleanliness detection module, a microbial species detection module, a main control module, a network communication module, a microbial function analysis module, a safety evaluation module and a display module. Through the microbial function analysis module, the procedure of analyzing microbial population functions is simplified, and the time is saved; according to the method for analyzing the microbial population function by utilizing the metagenome data, the splicing and prediction processes of sequencing reads are removed, and the function annotation of genes does not need to be carried out by comparing with a conventional single-function database, so that the data analysis time is greatly saved, and the running speed of the whole sequencing data analysis process is increased; and meanwhile, the microorganism safety level can be accurately evaluated through the safety evaluation module.
Owner:JIANGSU SUPERVISION & INSPECTION INST FOR PROD QUALITY