Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Brown tide algae species detection method and kit

A technology for detection kits and detection methods, applied in the direction of microorganism-based methods, biochemical equipment and methods, measurement/inspection of microorganisms, etc., can solve problems such as difficulties in identifying brown tide algae species, and achieve short detection time and easy control , good specific effect

Active Publication Date: 2015-04-29
CHINESE RES ACAD OF ENVIRONMENTAL SCI
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The technical problem to be solved by the present invention is to provide a qualitative and quantitative brown tide algae detection method in view of the difficulty in identifying brown tide algae species by traditional methods, which has high sensitivity, good reproducibility, continuous measurability, easy operation, Easy to control, short analysis time, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brown tide algae species detection method and kit
  • Brown tide algae species detection method and kit
  • Brown tide algae species detection method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] A. anophagefferens pure algal strain sample to the verification of the constructed quantitative PCR detection method:

[0094] Take 3 sterilized 3000mL Erlenmeyer flasks, add 1200mL sterilized seawater, add (f / 2-Si) culture solution at a ratio of 1 / 1000, and take 300mL from the same culture flask of A.anophagefferens in the exponential growth phase Inoculate in these 3 Erlenmeyer flasks, after culturing for 9 days, count under the microscope, the counting method is the same as the step b) of the above-mentioned step 2), and the result is 3.2 × 10 6 cells / L. Filtered with a 0.45 μm filter membrane, the number of algae cells obtained was 3.2×10 6 cells, 3.2×10 3 cells and 3.2×10 2 Cells samples, and extract the DNA in these samples. After purification, use the purified DNA as a template to perform fluorescent quantitative PCR amplification with primers AanF, AanR and probe Aan probe. For the fluorescent quantitative PCR reaction system and reaction conditions, see The...

Embodiment 2

[0099] Embodiment 2 Utilizes the method of the present invention to detect environmental samples

[0100] First, sample collection: According to the main areas of brown tide outbreaks in Qinhuangdao's coastal waters from 2009 to 2012, the sampling station Q (119°'25.568''E, 39°'45.056'N) was set up, and the sampling time was from April 2013 to In September, the sampling frequency is once a month, collected at the beginning of the month. During the sampling period, the water temperature was 9.2-26.8°C and the salinity was 30-32psu.

[0101] Secondly, the extraction of total DNA from environmental samples: collect surface water samples (0-5cm) at station Q, take 500mL, filter it with a 0.45μm filter membrane immediately, and store the filter membrane (with algae cells) at -20°C for three times each time. in parallel; using the soil DNA extraction kit UltraClean TM SoilDNA Isolation Kit (Mo Bio Laboratories, Inc., Solana Beach, California, USA) extracted the total DNA of the a...

Embodiment 3

[0105] Example 3 Verification of the validity of the environmental sample test results:

[0106] In order to further verify the effectiveness of the A. anophagefferens algae cell fluorescent quantitative PCR detection technology described in the present invention in detecting environmental samples, high-throughput sequencing technology was used to simultaneously detect these environmental samples.

[0107] High-throughput sequencing technology (pyrosequencing), called next-generation sequencing technology, can not only detect various known micro-organisms, but also discover new species, so as to understand the whole picture of all micro-organisms in an environment, even those with a small amount. species. At present, this technology has been widely used to detect the composition of microbiological communities in various environmental samples, such as seawater, soil, and wastewater treatment systems.

[0108] The Qinhuangdao Q site obtained in Example 2 was used as a template ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a brown tide algae species detection method which comprises the following steps: 1) designing and synthesizing specific primers AanF and AanR and an Aan probe, wherein the sequence of the AanF is AAAGCTCGTAGTTGGATTCCTGG; the sequence of the AanR is GTGTTCAACGCACGCTTACG; the sequence of the Aan probe is CTTGCGATGGTCTATCCT; 2) selecting a standard algal strain and constructing a recombinant plasmid standard; 3) constructing a standard curve; 4) verifying the specificities of the primers AanF and AanR and the Aan probe; 5) performing sample detection and result analysis. The detection method provided by the invention can be used for qualitative and quantitative detection of a brown tide algae species and has the advantages of high sensitivity, good reproducibility, continuous measurement, good convenience and high simplicity in operation, high easiness in control, short analysis time and the like.

Description

technical field [0001] The invention relates to the technical field of algae detection, in particular to a brown tide algae detection method and a kit. Background technique [0002] The brown tide alga Aureococcus anophagefferens belongs to Stramenopiles and Pelagophyceae in taxonomy. Since 2009, a harmful red tide—brown tide—caused by Aureococcus anophagefferens (abbreviated as A. anophagefferens) has appeared in the coastal waters of Qinhuangdao, my country, which has caused extremely serious impacts on Beidaihe coastal tourism and aquaculture. For our country, the brown tide is a new type of ecological disaster. The algal cells of the causative species A. anophagefferens are not only too small (about 3 μm), but also have no obvious morphological characteristics. The traditional method of observing the morphology of algal cells under a microscope is used to carry out the investigation. Species identification is very difficult, and it is urgent to find a fast and effective...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/89
CPCC12Q1/6851C12Q2545/113C12Q2563/107
Inventor 王丽平郑丙辉
Owner CHINESE RES ACAD OF ENVIRONMENTAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products