Rice seedling stage biomass regulation gene SBM1 and application thereof
A technology for regulating genes and biomass, applied in the field of plant genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1: Mapping of Rice Seedling Biomass QTL SBM1
[0056] 1. Rice materials and targeting groups
[0057] The present invention utilizes BC comprising 132 strains derived from the combination of 93-11 and PA64s 1 f 13 Recombinant inbred line populations were used for initial QTL mapping analysis of seedling biomass. In order to quickly obtain a near-isogenic line containing the target QTL SBM1, carry out verification and fine mapping, use molecular markers closely linked to SBM1 in the existing chromosomal substitution line population derived from Nipponbare (NPB) and Kasalath matching M1 and M4, the line SBM1 containing the Kasalath introgression fragment in the SBM1 interval under the NPB genetic background was screened Kasalath , and backcrossed the introgression line with the recurrent parent NPB for 4 consecutive generations, the genetic background was highly consistent with that of NPB, and the SBM1 interval was the BC of the heterozygous fragment of NPB an...
Embodiment 2
[0067] Embodiment 2: the method for gene knockout SBM1 gene improvement rice biomass and yield
[0068] Using the cDNA of NPB as a template, the primers SBM1-cDNA-F and SBM1-cDNA-R were used to amplify, and the fragments were sequenced for sequence comparison analysis.
[0069] SBM1-cDNA-F: 5'-ATGGAATCCAGCGAACAATGCGCCCTC-3',
[0070] SBM1-cDNA-R: 5'-TTACACCACCGCGTACATCACGGTGGT-3'.
[0071] The SBM1 gene contains a 4819bp nucleotide sequence (ie, the SBM1 gDNA sequence), as shown in SEQ ID No:1. The 885bp full-length cDNA sequence (SEQ ID No: 2) of the SBM1 gene was obtained by PCR amplification. The protein encoded by the gene has a sequence of 294 amino acids shown in SEQ IS No: 3, and the stop codon (TAA) is omitted at the end. To construct the CRISPR / Cas9 vector, insert the sgRNA target sequence of the target gene into the CRISPR / Cas9 vector to obtain the vector 65110-cas9 and 65120-cas9 vector, where the primer sequences are:
[0072] 65110-U3F:GGCAACCTGATCACGTACCTGAC,...
Embodiment 3
[0083] Example 3: SBM1 participates in the regulation of nitrogen use efficiency and affects rice yield
[0084] In order to investigate whether SBM1 affects nitrogen use efficiency and rice yield, the present invention utilizes NPB and NIL-SBM1 Kasalath , a comparative test of two nitrogen application rates was carried out under field conditions. The nitrogen fertilizer treatment experiment in the field was designed to plant three plots for each material, the plant-to-row spacing was 15×25 cm, and the plot size was 4.0×4.0 m. Different nitrogen treatments were repeated 3 times. Urea was used as the only nitrogen source, and the application rates of urea in the two treatments were 180kg / ha (High nitrogen, HN) and 90kg / ha (Lownitrogen, LN), respectively, and were applied three times at the seedling stage, tillering stage and jointing stage, each accounting for the total 30%, 40%, 30% of the amount of urea. Superphosphate as phosphate fertilizer (90kg / ha) and potassium chlorid...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


