Cucumber CsSTK gene, protein, expression vector and application

A technology for expressing vectors and genes, applied in the field of molecular biology, can solve the problems of long time, slow onset, no reports on cucumber STK gene related research, etc., and achieve the effects of enhanced resistance and mild symptoms.

Active Publication Date: 2021-10-22
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing control methods mainly use chemical methods for prevention and control. Long-term use of chemical methods for prevention and control can prevent and control cucumber corynesporium leaf spot, but long-term use will easily lead to the emergence of pathogenic bacteria resistance.
At the same time, chemical pesticide residues have adverse effects on soil and human health.
In response to this situation, at present, it is mainly to breed new resistant varieties or find safer biological agents, but it takes a long time to cultivate resistant varieties and currently there is a shortage of resistant varieties of Corynesporium leaf spot, and although biological agents are relatively chemical The preparation is safer, but the cost is high and the onset of action is slow
In addition, at present, there are very few studies on Corynesporium leaf spot of cucumber, and most of them focus on the research on the physiology and biochemistry, drug resistance and genetic diversity of pathogenic bacteria, and the research on the mechanism of disease resistance is still in its infancy.
[0003] With the continuous advancement of molecular technology and the completion of cucumber genome sequencing, a variety of transcription factors in cucumber genome have been systematically analyzed, such as ERF, MLO, etc., but there is little research on the function of cucumber STK genes, especially the relationship between cucumber STK There is no report on the correlation between the resistance of Corynesporium leaf spot

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cucumber CsSTK gene, protein, expression vector and application
  • Cucumber CsSTK gene, protein, expression vector and application
  • Cucumber CsSTK gene, protein, expression vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Cloning of Example 1 Cucumber CsSTK Gene

[0040] Using the cDNA of D9320 fresh leaves 48 hours after inoculation with the pathogen Corynespora leaf spot as a cloning template, Primerpremier 6.0 was used to design specific primers for cloning the full-length CsSTK gene and perform PCR amplification.

[0041] Specific primers are as follows:

[0042] CsSTK-F: ATGTCAAAGGTTCTTGCAGC

[0043] CsSTK-R: TTACTTTGTGGTTTTGAACAACTG

[0044] 20 μL amplification reaction system, including the following components: 10 μL 2×Taq PCR MasterMix, 0.5 μL upstream primer, 0.5 μL downstream primer, 1 μL cDNA template, ddH 2 O 8 μL.

[0045] PCR amplification program: 94°C for 2min; 94°C for 30s, 52°C for 30s, 72°C for 1min, 30 cycles; 72°C for 10min; 4°C Hold.

[0046] The amplified target fragment was ligated with the pEASY-T3 vector to obtain pEASY-T3-CsSTK E. coli bacterial liquid, which was identified by PCR and sent to Harbin Qingke Biological Company for sequencing. The electrophor...

Embodiment 2

[0047] Construction and transformation of embodiment 2 plant overexpression vector

[0048] The full-length primers of the cloned gene CsSTK were used for cloning and gel recovery. The pCXSN-1250 vector is a plant expression vector, which contains a 35s promoter, and the pCXSN-1250 empty vector is single-digested with restriction endonuclease XcmⅠ. Mix the cut empty vector and the target fragment according to the ratio, and use T4 ligase to ligate at 16°C for 16 hours to obtain the pCXSN-CsSTK overexpression vector, and transfer it into DH-5α competent cells by freeze-thaw method. The culture was screened on the medium containing Kan, and colony PCR identification was carried out after 12 hours.

[0049] pCXSN-CsSTK sequencing primers:

[0050] pCXSN-1250-F: CGGCAACAGGATTCAATCTTA;

[0051] pCXSN-1250-R: CAAGCATTCTACTTCTATTGCAGC.

[0052] The amplification system and reaction procedure are the same as in Example 1.

[0053] The results of electrophoresis of the PCR product...

Embodiment 3

[0055] Embodiment 3 Transgenic positive plants are obtained

[0056] Soak the seeds in warm water for 30 minutes, remove the seed coat, sterilize with 75% ethanol for 1 minute and remove the surface tension of the seeds, then sterilize with 2-3% sodium hypochlorite for 10 minutes, rinse with sterilized water several times, remove the disinfectant on the surface of the seeds, After drying the water with sterilized filter paper, spread it evenly in the germination medium (MS solid powder 4.33g L -1 +30g·L -1 Sucrose+2g·L -1 Phytogel, pH=5.8), cultured in the dark at 28°C for 48h.

[0057] Use 1 / 2MS medium (1 / 2MS solid powder 4.33g L -1 +30g·L -1 Sucrose, pH=5.8) resuspend the above pCXSN-CsSTK overexpression vector into Agrobacterium tumefaciens cells, cut off the protective film on the surface of the above cultured seeds under sterile conditions, peel off the cotyledon, remove the growth point and hypoembryon axis, and use the bacterial liquid to infect by shaking, after t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cucumber CsSTK gene, a protein, an expression vector and application, and belongs to the technical field of molecular biology. The invention discloses a cucumber CsSTK gene. The nucleotide sequence of the cucumber CsSTK gene is as shown in SEQ ID NO: 1; the amino acid sequence of the protein coded by the CsSTK gene is shown as SEQ ID NO: 2; the invention also discloses an expression vector containing the CsSTK gene. The invention also discloses an application of the CsSTK gene or the protein or the expression vector in improving the resistance of the cucumber corynespora leaf spot disease. Genetic engineering verifies that a transgenic plant obtained through overexpression of CsSTK is inoculated and identified, the disease symptom of the cucumber corynespora leaf spot is obviously relieved, and it is indicated that the overexpression of CsSTK can obviously enhance the resistance to the cucumber corynespora leaf spot disease.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a cucumber CsSTK gene, protein, expression vector and application. Background technique [0002] Cucumber (scientific name: Cucumis sativus L.) is an annual vine or climbing herbaceous plant of Cucurbitaceae, which is widely cultivated in various parts of China. Cucumbers are easily infected by a variety of pathogenic bacteria during production, which seriously affects their yield and quality. Cucumber Corynespora leaf spot is a common fungal disease, mainly caused by the pathogenic fungus Corynespora cassiicola. Existing control methods mainly use chemical methods for prevention and control. Long-term use of chemical methods for prevention and control can prevent and control cucumber corynesporium leaf spot, but long-term use will easily lead to the generation of drug resistance of pathogenic bacteria. At the same time, chemical pesticide residues have adverse effect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/34
CPCC07K14/415C12N15/8282
Inventor刘东秦智伟辛明张艳菊周秀艳潘春清
OwnerNORTHEAST AGRICULTURAL UNIVERSITY