Check patentability & draft patents in minutes with Patsnap Eureka AI!

Protein PtsuOBP39 bound with volatile compounds of Cinnamomum camphora and insect pheromone, attractant and application of protein PtsuOBP39 and attractant

A technology of volatile compounds and pheromones, applied in the field of molecular biology, can solve problems such as odor-binding proteins OBPs that have not been reported

Active Publication Date: 2021-10-29
NANJING FORESTRY UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, a variety of insect OBPs have been cloned and studied, but the OBPs of the Odorus chinensis adults have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein PtsuOBP39 bound with volatile compounds of Cinnamomum camphora and insect pheromone, attractant and application of protein PtsuOBP39 and attractant
  • Protein PtsuOBP39 bound with volatile compounds of Cinnamomum camphora and insect pheromone, attractant and application of protein PtsuOBP39 and attractant
  • Protein PtsuOBP39 bound with volatile compounds of Cinnamomum camphora and insect pheromone, attractant and application of protein PtsuOBP39 and attractant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Cloning of PtsuOBP39 Gene

[0035] (1) Breeding of Cinnamomum sinensis

[0036] During the rearing, the male and female adults of Cinnamomum chinensis were separated by a gauze net in the middle of the breeding box, and the male and female adults (35 days old, normally feeding but not mated) in the same batch of eclosion were collected for transcriptome sequencing. Three independent biological replicates were set up for both male and female adults, and each replicate contained 6 adults of the same sex. All samples were collected at the same time and cleaned with 75% alcohol, and immediately frozen in liquid nitrogen, stored at -80°C or directly extracted from total RNA.

[0037] (2) Extraction of RNA from male and female adults of Cinnamomum chinensis

[0038] Select the TRIzol (Treasure Biological Engineering (Dalian) Co., Ltd. TaKaRa, Japan) method to extract the total RNA of the male and female adults of Cinnamomum camphorensis, and the extraction steps are as foll...

Embodiment 2

[0089] Relative expression level of PtsuOBP39 gene in the tissues of male and female adults of Cinnamomum chinensis

[0090] (1) Breeding and sample collection of Cinnamomum sinensis

[0091] The field collection and breeding of Cinnamomum camphorus are the same as in Example 1. During rearing, the male and female adults were separated by gauze in the middle of the rearing box, and the male and female adults (35 days old, normally fed but not mated) in the same batch of eclosion were collected for dissection. Three independent biological replicates were set up for both male and female adults, and each replicate contained 30 adults of the same sex. All samples were collected at the same time and cleaned with 75% alcohol, and immediately dissected on ice to obtain antennae, head (excluding antennae), chest, abdomen end, wings and feet and other tissues, and quickly placed them in liquid nitrogen for freezing. Store at -80°C immediately after freezing or proceed directly to tot...

Embodiment 3

[0111] Prokaryotic expression and purification of PtsuOBP39

[0112] (1) Construction of prokaryotic expression vector based on the principle of homologous recombination

[0113] (1) The signal peptide sequence (SEQ ID NO: 9: ATGGGAAAAAGTGCAATATTTTGTGTGGTATTTGTATCCTACTTTTTGGGAGTAGTACAGCTTGGGAGTAGTACAGCTT) of the PtsuOBP39 gene was removed, and the primer design software CE Design (http: / / www. .vazyme.com, Novizyme’s official website) to design primers for the target fragments containing homologous sequences at both ends of the linearized vector; construct primers for the PtsuOBP39 prokaryotic expression vector as follows:

[0114] F: 5'-cgcggatccgaattcgagctcACACCTGTTCCATACCAACATTTATC-3' (SEQ ID NO: 7);

[0115] R: 5'-tggtggtgctcgagtgcggccgcTTATGATATATCATTTGAGATAATGGCC-3' (SEQ ID NO: 8).

[0116] (2) The expression vector pET28a(+) was double digested with two restriction endonucleases to linearize pET28a(+). The PCR reaction system is shown in Table 7.

[0117] Table 7 PCR ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention provides a protein PtsuOBP39 bound with volatile compounds of Cinnamomum camphora and insect pheromone, an attractant and application of the protein PtsuOBP39 and the attractant and belongs to the technical field of molecular biology. The odorant-binding protein is PtsuOBP39, an amino acid sequence of the odorant-binding protein is shown as SEQ ID NO: 1, and a coding gene of the odorant-binding protein is shown as SEQ ID NO: 2. The protein and the gene can be used for reversely verifying and screening key components of the attractant for the pest Pagiophloeus tsushimanus, a foundation is laid for analyzing an olfactory molecular mechanism of the Pagiophloeus tsushimanus, and a reference basis is also provided for developing a pest prevention and control technology taking a pest olfactory key gene as a target. The screened (1alpha,3alpha,4alpha,6alpha)-4,7,7-trimethylbicyclo[4.1.0]heptan-3-ol Cinnamomum-camphora volatile compounds capable of being specifically bound with the protein are used for preparing the attractant, and a new way of think is provided for monitoring, preventing and controlling the Pagiophloeus tsushimanus.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to a protein PtsuOBP39 combined with camphor volatile compounds and worm body pheromones, an attractant and applications thereof. Background technique [0002] Pagiophloeus tsushimanus (Pagiophloeus tsushimanus) belongs to Coleptera (Coleptera), weevil family (Curculionidae), Pagiophloeus (Pagiophloeus), is a new record pest in China that bores camphor. Adults mainly feed on the epidermis of twigs that are 1 to 2 years old, and larvae feed on the cambium. When the population density is high, the growth of camphor is weakened or the whole plant dies. At present, Cinnamomum sinensis is only distributed in Shanghai, China. It has one generation per year and overwinters as larvae and adults. [0003] Insects perceive odor substances in the external environment through the olfactory system to regulate their behavior. The method of regulating insect behavior based on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/70A01N31/06A01N35/06A01N27/00A01N49/00A01P19/00
CPCC07K14/43563C12N15/70A01N31/06A01N35/06A01N27/00A01N49/00
Inventor 何玄玉郝德君韩阳阳王焱樊斌琦陈聪朱晗
Owner NANJING FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More