Unlock instant, AI-driven research and patent intelligence for your innovation.

Application and preparation method of nanoparticles formed by wrapping protamine with erythrocyte membrane after DNA compression

A technology of protamine and nano particles, which is applied in the application and preparation of nanoparticles, can solve the problems of myocardial liver damage and human body damage, etc., and achieve strong preventive effects, avoid damage, and increase preventive effects Effect

Pending Publication Date: 2021-11-02
THE SECOND HOSPITAL AFFILIATED TO WENZHOU MEDICAL COLLEGE
View PDF10 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although DOX has a significant effect on cancer treatment, its damage to the human body is also very obvious
[0005] The existing patent application number is CN202010284531.3, which discloses the medical use of a CREG protein for the prevention or treatment of adriamycin myocardial injury. According to the description of the patent text, it can be seen that the invention is to treat the damaged myocardium. Timely treatment will still leave damage to the myocardium and / or liver, and there is still a large burden on the patient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application and preparation method of nanoparticles formed by wrapping protamine with erythrocyte membrane after DNA compression
  • Application and preparation method of nanoparticles formed by wrapping protamine with erythrocyte membrane after DNA compression
  • Application and preparation method of nanoparticles formed by wrapping protamine with erythrocyte membrane after DNA compression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The application of nanoparticles composed of protamine compressed DNA and wrapped by red blood cell membrane in the detoxification of doxorubicin.

[0034] Combine this protamine with DNA to form a "chromosome-like" nano-scale substance, and then use the red blood cell membrane to wrap the nano-particles, which can be used to detoxify doxorubicin, which can protect myocardial and / or liver cells and avoid Violated by DOX. The above-mentioned nanoparticles are laid out in advance. When DOX is close to cardiac muscle and / or liver cells, the nanoparticles used as bait can form a defense line against DOX. When DOX interacts with nanoparticles, the GC base pair of DNA in the nanoparticles can be used. DOX produces specific binding, and then adsorbs the toxin effect of DOX and cardiac muscle and / or liver cells. Pre-arranging a large number of nanoparticles in places that need to be protected, such as cardiac muscle and / or liver cells, can play a very good protective role.

...

Embodiment 2

[0039] Red blood cell membrane (RBCM) preparation

[0040] Red blood cells are derived from C57BL / 6 mice, and the process is as follows: centrifuge at 3000-5000 rpm for 15 minutes to remove white blood cells, platelets and serum to obtain red blood cells. Add 250 μL of pure red blood cells to 950 μL of ultrapure water, ice-bath for 30-60 minutes, add 20x PBS to adjust the osmotic pressure to 1x, mix well, centrifuge at 14,000 rpm for 10 minutes, discard the supernatant, add 950 μL of ultra-pure water to resuspend, and ice-bath again , adjust the osmotic pressure, centrifuge, and circulate until the supernatant is free of hemoglobin, and collect the precipitate, such as figure 1 shown. The collected precipitate is the red blood cell membrane (Red Blood Cell Membrane, RBCM). The concentration of membrane proteins in RBCM was determined by the BCA method.

Embodiment 3

[0042] DNA preparation

[0043] Using the green fluorescent protein plasmid DNA as a template, design the front primer CGGCCACAAGTTCGTGAT and the back primer AATCCAGAGGTTGATTGTTCCA, the DNA sequence to be obtained is about 630bp, and its sequence is

[0044]CGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCCTGAACGCGTCTGGAACAATCAACCTCTGGATT。 Subsequently, the plasmid DNA was amplified by a PCR machine, the amplified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application and a preparation method of nano-particles formed by compressing DNA of protamine and wrapping the protamine with an erythrocyte membrane, and the preparation method comprises the following steps: S1, obtaining DNA and protamine, and carrying out ultrasonic combination to obtain the nano-particles; S2, wrapping the nano-particles with the erythrocyte membrane through an extrusion method to obtain a target substance. The substance obtained on the basis of the preparation method can adsorb and detoxify DOX in a mode that the bait is specifically combined with the DOX.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to the application and preparation method of nanoparticles composed of protamine compressed DNA and wrapped by red blood cell membranes. Background technique [0002] Doxorubicin (DOX), as a classic chemotherapy drug, is widely used in the treatment of different cancer types. Although DOX exhibits good cancer therapeutic effects, its toxic side effects (including cardiotoxicity, liver toxicity, and gastrointestinal reactions) greatly limit its further clinical application. It is well known that the main mechanism of DOX killing cancer cells is to bind to double-stranded DNA in cancer cells to inhibit DNA replication in the nucleus and induce cell apoptosis. In addition, DOX can be specifically inserted into the GC base pairs of DNA double strands. According to this feature, there have been studies on inserting DOX into double-stranded nucleic acids such as plasmids to achieve c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K9/51A61K31/7088A61K47/46A61K47/64A61P39/02
CPCA61K9/5176A61K47/64A61K31/7088A61P39/02
Inventor 陈一杰诸海燕姜琦陈梦纯诸葛德力饶大庞王芳卢晓声
Owner THE SECOND HOSPITAL AFFILIATED TO WENZHOU MEDICAL COLLEGE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com