Unlock instant, AI-driven research and patent intelligence for your innovation.

Method capable of improving homologous recombination efficiency of CRISPR/Cas9 system and application

A technology of homologous recombination and fusion protein, applied in other methods of inserting foreign genetic materials, recombinant DNA technology, chemical instruments and methods, etc., can solve the problem of low efficiency of HDR

Inactive Publication Date: 2021-11-19
SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV +2
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problem of low HDR efficiency of the current CRISPR / Cas9 system, this invention describes a new CRISPR / Cas9-mediated system for improving the efficiency of HDR homologous recombination. The system is mainly composed of three parts: Cas9-TetR fusion protein, Guide RNA (gRNA) and donor DNA containing elements of the tetracycline operator (tetO)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method capable of improving homologous recombination efficiency of CRISPR/Cas9 system and application
  • Method capable of improving homologous recombination efficiency of CRISPR/Cas9 system and application
  • Method capable of improving homologous recombination efficiency of CRISPR/Cas9 system and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Cas9, Cas9-tetR series expression vector construction

[0040] pcDNA3.1-Cas9, pcDNA3.1-Cas9-GGGGS-TetR, pcDNA3.1-Cas9-(GGGGS)2-TetR, pcDNA3.1-Cas9-(GGGGS)4-TetR expression vector construction process is as follows:

[0041] 1) Cas9 protein coding sequence and TetR domain protein coding sequence were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and the sequence information is SEQ ID NO:1-2;

[0042]2) According to the pcDNA3.1 backbone vector sequence Cas9, Cas9-GGGGS-TetR, Cas9-(GGGGS)2-TetR and Cas9-(GGGGS)4-TetR insertion element sequences, design PCR primers respectively (primer sequence information is shown in the table below , SEQ ID NO:3-9), using synthetic Cas9 and TetR fragments as templates to amplify Cas9, GGGGS-TetR, (GGGGS)2-TetR and (GGGGS)4-TetR fragments, through fragment In-Fusion ( In-Fusion kit was purchased from Takara Company), and the construction obtained pcDNA3.1-Cas9, pcDNA3.1-Cas9-GGGGS-TetR, pcDNA3.1-Cas9-(GGGGS)2-TetR, pcDNA3.1-...

Embodiment 2

[0045] Comparison of the cleavage activity of Cas9 and Cas9-tetR fusion proteins against the target sequence Cas9

[0046] The CHO-K1-EGFP cell line constructed by the inventor was used as the verification method for three Cas9-tetR (protein structure such as figure 2 As shown in Figure A in the figure) the verification system for the nuclease cleavage activity of the target sequence, the principle of the system is schematically shown as figure 2 Shown in Figure B. In previous work, the inventors inserted a CAG-EGFP-IRES-BSD-polyA expression cassette site-specifically into the CAAGTATACACTTGAGCCAGTAGTGGGGGGAGGGGTGG (SEQ ID NO: 10) site of the CHO-K1 cell line. By constructing the gRNA expression vector targeting EGFP and co-transfecting the CHO-K1-EGFP cell line with the Cas9 expression vector and three Cas9-tetR expression vectors, Cas9 cuts the EGFP site under the guidance of the gRNA, resulting in NHEJ. If the frame shifts, the EGFP fluorescence will disappear. If there...

Embodiment 3

[0054] Effects of different tetO quantities and positions on Cas9-tetR-mediated homologous recombination HDR efficiency

[0055] The IRES-tdTomato expression cassette was inserted into the 3'UTR region of the Neuro2a cell line Actin gene by homologous recombination, and the detection system of the HDR efficiency of homologous recombination was evaluated by the ratio of tdTomato fluorescent cells to evaluate the effect of different tetO quantities and positions on Cas9-(GGGGS) The influence of 4-TetR (hereinafter referred to as "Cas9-tetR")-mediated homologous recombination HDR efficiency, the schematic diagram of the detection system principle is as follows image 3 As shown in Figure A: In this system, only when the IRES-tdTomato element is inserted into the transcribed region of the gene will there be tdTomato fluorescence expression; Actin is a housekeeping gene, which is continuously highly expressed in cells, by targeting Actin 3' Design gRNA in the UTR (Untranslated regi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method capable of improving the homologous recombination efficiency of a CRISPR / Cas9 system and application. The CRISPR / Cas9 system comprises a Cas9-TetR fusion protein, guide RNA and a vector containing a tetracycline operon (tetO) element. The invention provides the method for carrying out homologous recombination by utilizing the CRISPR / Cas9 system. According to the method, a recombinant vector or Cas9 protein does not need to be subjected to additional chemical modification and purification, and the homologous recombinant vector only needs to be constructed into the skeleton vector containing the tetO element like conventional vector construction; the positive rate of homologous recombination of mediated DNA large fragments (more than 2000 base pairs) can be improved; and the homologous recombination positive rate can be improved by 2-3 times in the preparation of a gene modification animal model.

Description

technical field [0001] The invention belongs to the field of bioengineering technology, specifically to the field of recombination technology. Background technique [0002] Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) system is an adaptive immune defense mechanism formed during the long-term evolution of bacteria and archaea to fight against invading viruses and foreign bodies. source DNA. The Cas9 nuclease of the CRISPR / Cas9 system can be guided by a single-stranded guide RNA (gRNA), and through the combination of the gRNA and a specific target sequence, it can cause DNA double-strand breaks at a specific target site in the genome, effectively exerting the gene editing function, It is an important tool for genome editing in various organisms. In mammalian cells, DNA double-strand breaks triggered by CRISPR / Cas9 can be repaired by at least two different competing mechanisms, namely non-homologous end joining (NHEJ) a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/113C12N15/63C12N15/90A01K67/027
CPCC12N9/22C12N15/113C12N15/63C12N15/907C07K14/4703A01K67/0278A01K67/0276C07K2319/00C12N2310/20C12N2830/006A01K2207/15A01K2217/072A01K2217/075A01K2227/105
Inventor 孙瑞林王津津周宇
Owner SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV