Method capable of improving homologous recombination efficiency of CRISPR/Cas9 system and application
A technology of homologous recombination and fusion protein, applied in other methods of inserting foreign genetic materials, recombinant DNA technology, chemical instruments and methods, etc., can solve the problem of low efficiency of HDR
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Cas9, Cas9-tetR series expression vector construction
[0040] pcDNA3.1-Cas9, pcDNA3.1-Cas9-GGGGS-TetR, pcDNA3.1-Cas9-(GGGGS)2-TetR, pcDNA3.1-Cas9-(GGGGS)4-TetR expression vector construction process is as follows:
[0041] 1) Cas9 protein coding sequence and TetR domain protein coding sequence were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and the sequence information is SEQ ID NO:1-2;
[0042]2) According to the pcDNA3.1 backbone vector sequence Cas9, Cas9-GGGGS-TetR, Cas9-(GGGGS)2-TetR and Cas9-(GGGGS)4-TetR insertion element sequences, design PCR primers respectively (primer sequence information is shown in the table below , SEQ ID NO:3-9), using synthetic Cas9 and TetR fragments as templates to amplify Cas9, GGGGS-TetR, (GGGGS)2-TetR and (GGGGS)4-TetR fragments, through fragment In-Fusion ( In-Fusion kit was purchased from Takara Company), and the construction obtained pcDNA3.1-Cas9, pcDNA3.1-Cas9-GGGGS-TetR, pcDNA3.1-Cas9-(GGGGS)2-TetR, pcDNA3.1-...
Embodiment 2
[0045] Comparison of the cleavage activity of Cas9 and Cas9-tetR fusion proteins against the target sequence Cas9
[0046] The CHO-K1-EGFP cell line constructed by the inventor was used as the verification method for three Cas9-tetR (protein structure such as figure 2 As shown in Figure A in the figure) the verification system for the nuclease cleavage activity of the target sequence, the principle of the system is schematically shown as figure 2 Shown in Figure B. In previous work, the inventors inserted a CAG-EGFP-IRES-BSD-polyA expression cassette site-specifically into the CAAGTATACACTTGAGCCAGTAGTGGGGGGAGGGGTGG (SEQ ID NO: 10) site of the CHO-K1 cell line. By constructing the gRNA expression vector targeting EGFP and co-transfecting the CHO-K1-EGFP cell line with the Cas9 expression vector and three Cas9-tetR expression vectors, Cas9 cuts the EGFP site under the guidance of the gRNA, resulting in NHEJ. If the frame shifts, the EGFP fluorescence will disappear. If there...
Embodiment 3
[0054] Effects of different tetO quantities and positions on Cas9-tetR-mediated homologous recombination HDR efficiency
[0055] The IRES-tdTomato expression cassette was inserted into the 3'UTR region of the Neuro2a cell line Actin gene by homologous recombination, and the detection system of the HDR efficiency of homologous recombination was evaluated by the ratio of tdTomato fluorescent cells to evaluate the effect of different tetO quantities and positions on Cas9-(GGGGS) The influence of 4-TetR (hereinafter referred to as "Cas9-tetR")-mediated homologous recombination HDR efficiency, the schematic diagram of the detection system principle is as follows image 3 As shown in Figure A: In this system, only when the IRES-tdTomato element is inserted into the transcribed region of the gene will there be tdTomato fluorescence expression; Actin is a housekeeping gene, which is continuously highly expressed in cells, by targeting Actin 3' Design gRNA in the UTR (Untranslated regi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



