Check patentability & draft patents in minutes with Patsnap Eureka AI!

Tobacco NtIMK2 receptor protein kinase and application thereof in drought resistance

A receptor protein and tobacco technology, applied in the field of tobacco genome function analysis, can solve problems such as differences in gene functions, gene regulation methods and practical uses

Active Publication Date: 2021-11-19
ZHENGZHOU TOBACCO RES INST OF CNTC
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the study of genes related to drought stress, due to different types of crops, gene functions are different, resulting in many differences in actual gene regulation methods and practical uses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco NtIMK2 receptor protein kinase and application thereof in drought resistance
  • Tobacco NtIMK2 receptor protein kinase and application thereof in drought resistance
  • Tobacco NtIMK2 receptor protein kinase and application thereof in drought resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Based on the inventor's previous analysis work on the tobacco genome, using phosphoproteomics, transcriptome, and miRNA-seq and other multi-omics integration analysis methods, the invention speculates that the tobacco LRR receptor kinases (RLKs) NtIMK2 gene is in It has a certain function in drought resistance. For this reason, this embodiment briefly introduces the cloning process of the NtIMK2 gene as follows.

[0054] (1) Genome extraction

[0055] The K326 seeds were sterilized and inoculated on MS medium for germination. After two weeks of germination, the seedlings were transplanted into pots and cultivated in a plant culture room with a cultivation temperature of 23-26°C. The fourth leaf with a leaf age of six weeks was taken. Genomic DNA was extracted using a plant genomic DNA extraction kit.

[0056] When extracting genomic DNA, refer to the kit instruction manual, or refer to the following:

[0057] First, put the Spin Column in the Collection Tube, add 250...

Embodiment 2

[0079] On the basis of Example 1, in order to determine the specific response of the NtIMK2 gene to drought stress, based on the pC2300S vector, the inventor further constructed a recombinant overexpression vector and further overexpressed it. This example is related to The brief introduction of the experiment process is as follows.

[0080] (1) Construction of overexpression vector

[0081] Based on the sequencing results of the NtIMK2 sequence in the previous examples, by analyzing it, design primers for PCR amplification, and further recombine the NtIMK2 gene into the pC2300S vector backbone by enzyme digestion (with KpnI and BamHI double enzyme digestion) and ligation , and finally carry out further identification to ensure that the plasmid recombination is correct. (For related operations, please refer to the existing routine operations of molecular biology, so I won’t repeat them here)

[0082] The specific plasmid pC2300S vector structure is as follows: figure 2 sho...

Embodiment 3

[0098]Example 2 is an introduction to the construction process of related overexpression transgenic plants, but in order to further determine the specific response of NtIMK2 gene in drought stress, on the basis of Example 1, the inventors further used RNAi silencing technology to silence the gene expression. Embodiments are as follows with regard to the brief introduction of relevant experimental process.

[0099] (1) Select the interference fragment sequence and perform PCR amplification

[0100] First, based on the sequencing results in Example 1, the sequence of the interference fragment was selected as follows (238bp):

[0101] AGCAAAACAACCCAACGATTGCAGATGTAGGCCTCTCCAGGCTTATGACAAGTGCTGGTAACACCAATGTGATTGCCACTGCAGGCACGTTAGGTTATCGTGCACCAGAGCTCTCGAAAATCAAGAATGCAAGCACCAAGACCGATGTCTATAGTGTTGGAGTGATCATTTTGGAGCTCTTGACTGGAAAATCACCAAGCGGGGCAACAGATGGACTCGATTTGGCCACTA

[0102] For the above interference fragment sequence, design primers for the forward interference fragment S, reverse...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of tobacco genome function analysis, and particularly relates to tobacco NtIMK2 receptor protein kinase and an application thereof in drought resistance. The length of the gene is 2511bp, and the base sequence of the gene is as shown in SEQ ID No.1. After the gene is over-expressed, the drought tolerance of a plant can be enhanced, and after the gene is silenced, the sensitivity of the plant to drought can be increased. In the early stage, on the basis of analysis of a tobacco genome, integrated analysis of multiple omics such as related phosphoproteomics, transcriptome, miRNA-seq and the like is combined, and it is found that expression of an LRR receptor kinase (RLKs) NtIMK2 gene is highly related to drought response. For further determining the function of the gene and the effect of the gene in a plant drought stress response mechanism, in the invention, the inventor preliminarily studies the function of the NtIMK2 gene in drought stress by using RNAi interference and overexpression technologies, and the result shows that when the NtIMK2 gene is overexpressed, the drought resistance of the plant can be obviously improved.

Description

technical field [0001] The application belongs to the technical field of tobacco genome function analysis, and specifically relates to a tobacco NtIMK2 receptor protein kinase and its application in drought resistance. Background technique [0002] Drought is one of the natural disasters that seriously damage the earth's ecosystem. It is characterized by wide range, high frequency and strong destructiveness, and often leads to severe global or regional economic losses. Insufficient water supply caused by drought can seriously affect agricultural production and reduce crop yields. Therefore, it is of great significance for the sustainable development of agriculture to analyze the drought response mechanism of plants and improve their drought resistance through targeted improvement of crops. [0003] In the existing research, the research on the mechanism of plant drought resistance mainly focuses on abscisic acid (ABA), reactive oxygen species (reactive oxygen species, ROS),...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/84A01H5/00A01H6/82
CPCC12N9/12C12N15/8273
Inventor 陈千思周会娜刘萍萍金立锋张慧郑庆霞徐国云翟妞曹培健
Owner ZHENGZHOU TOBACCO RES INST OF CNTC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More