Tobacco NtIMK2 receptor protein kinase and application thereof in drought resistance
A receptor protein and tobacco technology, applied in the field of tobacco genome function analysis, can solve problems such as differences in gene functions, gene regulation methods and practical uses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Based on the inventor's previous analysis work on the tobacco genome, using phosphoproteomics, transcriptome, and miRNA-seq and other multi-omics integration analysis methods, the invention speculates that the tobacco LRR receptor kinases (RLKs) NtIMK2 gene is in It has a certain function in drought resistance. For this reason, this embodiment briefly introduces the cloning process of the NtIMK2 gene as follows.
[0054] (1) Genome extraction
[0055] The K326 seeds were sterilized and inoculated on MS medium for germination. After two weeks of germination, the seedlings were transplanted into pots and cultivated in a plant culture room with a cultivation temperature of 23-26°C. The fourth leaf with a leaf age of six weeks was taken. Genomic DNA was extracted using a plant genomic DNA extraction kit.
[0056] When extracting genomic DNA, refer to the kit instruction manual, or refer to the following:
[0057] First, put the Spin Column in the Collection Tube, add 250...
Embodiment 2
[0079] On the basis of Example 1, in order to determine the specific response of the NtIMK2 gene to drought stress, based on the pC2300S vector, the inventor further constructed a recombinant overexpression vector and further overexpressed it. This example is related to The brief introduction of the experiment process is as follows.
[0080] (1) Construction of overexpression vector
[0081] Based on the sequencing results of the NtIMK2 sequence in the previous examples, by analyzing it, design primers for PCR amplification, and further recombine the NtIMK2 gene into the pC2300S vector backbone by enzyme digestion (with KpnI and BamHI double enzyme digestion) and ligation , and finally carry out further identification to ensure that the plasmid recombination is correct. (For related operations, please refer to the existing routine operations of molecular biology, so I won’t repeat them here)
[0082] The specific plasmid pC2300S vector structure is as follows: figure 2 sho...
Embodiment 3
[0098]Example 2 is an introduction to the construction process of related overexpression transgenic plants, but in order to further determine the specific response of NtIMK2 gene in drought stress, on the basis of Example 1, the inventors further used RNAi silencing technology to silence the gene expression. Embodiments are as follows with regard to the brief introduction of relevant experimental process.
[0099] (1) Select the interference fragment sequence and perform PCR amplification
[0100] First, based on the sequencing results in Example 1, the sequence of the interference fragment was selected as follows (238bp):
[0101] AGCAAAACAACCCAACGATTGCAGATGTAGGCCTCTCCAGGCTTATGACAAGTGCTGGTAACACCAATGTGATTGCCACTGCAGGCACGTTAGGTTATCGTGCACCAGAGCTCTCGAAAATCAAGAATGCAAGCACCAAGACCGATGTCTATAGTGTTGGAGTGATCATTTTGGAGCTCTTGACTGGAAAATCACCAAGCGGGGCAACAGATGGACTCGATTTGGCCACTA
[0102] For the above interference fragment sequence, design primers for the forward interference fragment S, reverse...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com