MicroRNA nano complex based on framework nucleic acid material as well as preparation method and application of microRNA nano complex

A nanocomposite, miRNA-2861 technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of poor miRNA structural stability and affecting miRNA action efficiency

Active Publication Date: 2021-12-03
SICHUAN UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the single-stranded structure of the loaded miRNA, the structural stability of the single-stranded miRNA is poorer than that of the double-stranded miRNA.
In addition, this transport method links miRNA to tFNAs through a phosphodiester bond. After entering the cell, the transported miRNA will form an RNA-induced silencing complex (RISC) to play a role in the cell. The presence of carriers may affect the efficiency of miRNA in cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MicroRNA nano complex based on framework nucleic acid material as well as preparation method and application of microRNA nano complex
  • MicroRNA nano complex based on framework nucleic acid material as well as preparation method and application of microRNA nano complex
  • MicroRNA nano complex based on framework nucleic acid material as well as preparation method and application of microRNA nano complex

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0045] DNA tetrahedral framework nucleic acid (tFNA) is synthesized by self-assembly of four uniquely designed DNA single strands (S1, S2, S3, S4) through PCR procedures, and its conventional preparation method includes the following steps:

[0046] Four DNA single strands S1, S2, S3 and S4 (the specific sequences are shown in Table 1) were dissolved in TM buffer (10mM Tris-HCl, 50mM MgCl2, pH 8.0) according to equimolar ratio, so that the final results of the four DNA single strands The concentration was 1000nM, mixed well, heated to 95°C and maintained for 10min, then rapidly cooled to 4°C and maintained for more than 20min, that is, DNA tetrahedral framework nucleic acid (tFNA) was synthesized by self-assembly.

[0047] Table 1. The specific sequences of the four DNA single strands for preparing tFNA

[0048]

Embodiment 1

[0049] Embodiment 1, preparation and characterization of the microRNA nanocomplex of the present invention

[0050] 1. s 1 Preparation and Characterization of tFNA-miR Nanocomplex

[0051] (1) Synthesis of DNA tetrahedron with 1 cohesive terminal vertex

[0052] According to the conventional DNA strand synthesis method, a DNA cohesive end was added to the 5' end of the DNA single strand S1 to obtain the DNA single strand sS1.

[0053] The sequence of DNA sticky end is: TTGACCTGTGAATT (SEQ ID NO.5)

[0054] The sequence of sS1 is:

[0055] TTGACCTGTGAATTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 6)

[0056] The DNA single strands sS1, S2, S3 and S4 were synthesized according to the above-mentioned tFNA conventional preparation method to synthesize tFNA with one sticky terminal apex (s 1 tFNA), the specific method is as follows:

[0057] The four DNA single strands sS1, S2, S3 and S4 were dissolved in TM buffer (10mM Tris-HCl, 50mM MgCl2, p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
sizeaaaaaaaaaa
Login to View More

Abstract

The invention provides a microRNA nano complex based on a framework nucleic acid material as well as a preparation method and application of microRNA nano complex, and belongs to the field of nucleic acid molecule medicines. The method comprises the following steps of firstly, providing a DNA tetrahedral framework nucleic acid with one or more DNA cohesive ends, and then providing a microRNA nano complex which is obtained by taking the DNA tetrahedral framework nucleic acid as a carrier and loading microRNA. According to the microRNA nano complex, the stability of the microRNA can be kept, the separation of the microRNA from a carrier DNA tetrahedron in a body can be realized, the action efficiency of the microRNA cannot be influenced, and the defects of poor stability and poor effect of a microRNA nano-composite material in the prior art are overcome. The microRNA nano composite material is high in cell entry effect, can be well ingested by BMSC, promotes osteogenic differentiation of BMSC, realizes in-vivo bone regeneration, has excellent biological activity, and is excellent in application prospect.

Description

technical field [0001] The invention belongs to the field of nucleic acid molecular medicines, and in particular relates to a microRNA nanocomposite based on a framework nucleic acid material and its preparation method and application. Background technique [0002] Based on the principle of Watson-Crick hybridization, DNA has good editability, which has also enabled DNA nanotechnology to develop rapidly and be widely used in various fields since it was first proposed in 1982. Due to the good biological stability, biocompatibility, editability, and excellent ability to penetrate cell membranes, DNA nanostructures have great application potential in the field of drug delivery. Among DNA nanostructures, DNA tetrahedral nanostructures have shown excellent drug delivery capabilities. It has been confirmed that the DNA tetrahedral framework nucleic acid structure (tFNA) can transport not only neutrally charged peptide nucleic acid, but also negatively charged DNA and RNA. As the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11A61K47/54A61K31/7088A61P19/08
CPCC12N15/111A61K47/549A61K31/7088A61P19/08C12N2310/141C12N2320/32Y02A50/30
Inventor林云锋李松航刘育豪蔡潇潇
OwnerSICHUAN UNIV