MicroRNA nano complex based on framework nucleic acid material as well as preparation method and application of microRNA nano complex
A nanocomposite, miRNA-2861 technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of poor miRNA structural stability and affecting miRNA action efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0045] DNA tetrahedral framework nucleic acid (tFNA) is synthesized by self-assembly of four uniquely designed DNA single strands (S1, S2, S3, S4) through PCR procedures, and its conventional preparation method includes the following steps:
[0046] Four DNA single strands S1, S2, S3 and S4 (the specific sequences are shown in Table 1) were dissolved in TM buffer (10mM Tris-HCl, 50mM MgCl2, pH 8.0) according to equimolar ratio, so that the final results of the four DNA single strands The concentration was 1000nM, mixed well, heated to 95°C and maintained for 10min, then rapidly cooled to 4°C and maintained for more than 20min, that is, DNA tetrahedral framework nucleic acid (tFNA) was synthesized by self-assembly.
[0047] Table 1. The specific sequences of the four DNA single strands for preparing tFNA
[0048]
Embodiment 1
[0049] Embodiment 1, preparation and characterization of the microRNA nanocomplex of the present invention
[0050] 1. s 1 Preparation and Characterization of tFNA-miR Nanocomplex
[0051] (1) Synthesis of DNA tetrahedron with 1 cohesive terminal vertex
[0052] According to the conventional DNA strand synthesis method, a DNA cohesive end was added to the 5' end of the DNA single strand S1 to obtain the DNA single strand sS1.
[0053] The sequence of DNA sticky end is: TTGACCTGTGAATT (SEQ ID NO.5)
[0054] The sequence of sS1 is:
[0055] TTGACCTGTGAATTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 6)
[0056] The DNA single strands sS1, S2, S3 and S4 were synthesized according to the above-mentioned tFNA conventional preparation method to synthesize tFNA with one sticky terminal apex (s 1 tFNA), the specific method is as follows:
[0057] The four DNA single strands sS1, S2, S3 and S4 were dissolved in TM buffer (10mM Tris-HCl, 50mM MgCl2, p...
PUM
Property | Measurement | Unit |
---|---|---|
size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com