Check patentability & draft patents in minutes with Patsnap Eureka AI!

High-discrimination detection kit and detection method for HBV pgRNA in trace sample

A detection kit and detection method technology, applied in the direction of microorganism-based methods, DNA/RNA fragments, microorganism measurement/inspection, etc., can solve the problems that trace samples cannot reach the detection limit and the detection sensitivity of HBVpgRNA is insufficient, etc. Achieve the effect of improving reliability and discrimination, avoiding loss of nucleic acid, and easy operation

Pending Publication Date: 2021-12-07
HUNAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims at the problem of insufficient detection sensitivity of HBV pgRNA in the existing detection technology, and the detection limit of trace samples cannot be reached, and provides a high-discrimination detection kit and detection method for HBV pgRNA in trace samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-discrimination detection kit and detection method for HBV pgRNA in trace sample
  • High-discrimination detection kit and detection method for HBV pgRNA in trace sample
  • High-discrimination detection kit and detection method for HBV pgRNA in trace sample

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] The principles and features of the present invention are described below, and the examples given are only used to explain the present invention, and are not intended to limit the scope of the present invention.

[0029] 1. Instruments, reagents, primers, cells, clinical samples

[0030] Instruments: ordinary PCR machine and fluorescent quantitative PCR machine.

[0031] Reagents: All reagents used were purchased from conventional biochemical reagent companies.

[0032] Primers: Two pairs of nested PCR primers were designed to increase the specificity of PCR amplification of the target fragment. The sequences of the nested PCR primers are shown in Table 1.

[0033] Table 1 Primer numbers and sequences

[0034] Primer sequence number Primer name Primer sequence SEQ NO:1 P-F1 GAGTGTGGATTCGCACTCC SEQ NO:2 P-R1 GAGGCGAGGGAGTTTCTTCT SEQ NO:3 P-F2 CCACCAAATGCCCCTATCCT SEQ NO:4 P-R2 GTTCTTTCTTCTAGGGGACCT

[0035] The leng...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high-discrimination detection kit and detection method for HBV pgRNA in a trace sample. The detection method comprises the following steps: (1) directly performing reverse transcription and PCR amplification on a sample to be detected by using one-step reverse transcription and PCR amplification, wherein used primers are a pair of nested PCR primers, the nucleotide sequence of forward primers P-F1 is shown as SEQ NO: 1, and the nucleotide sequence of reverse primers P-R1 is shown as SEQ NO: 2; (2) by using a product obtained through the one-step reverse transcription and the PCR amplification as a template, performing a fluorescent quantitative PCR reaction to detect the content of HBV pgRNA, wherein used primers are another pair of nested PCR primers, the nucleotide sequence of the forward primers P-F2 is shown as SEQ NO: 3, and the nucleotide sequence of the reverse primers P-R2 is shown as SEQ NO: 4.

Description

technical field [0001] The invention relates to a high-discrimination detection kit and detection method for HBV pgRNA in trace samples, belonging to the technical field of pathogenic microorganism molecular detection. Background technique [0002] Chronic hepatitis B is a major infectious disease caused by persistent chronic infection of hepatitis B virus (HBV). At present, interferon and nucleoside analogues are mainly used in the clinical treatment of patients with chronic hepatitis B, but long-term treatment of this kind has problems such as drug resistance and side effects, and it cannot achieve the ideal goal of completely eradicating the virus cccDNA Once the drug is stopped, the patient is at risk of relapse. [0003] Studies have shown that the level of HBV pgRNA in blood is closely related to the treatment and prognosis of chronic hepatitis B. Highly differentiated detection of HBV pgRNA in blood can indirectly reflect the active level of HBV cccDNA transcription...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/706C12Q1/6851C12Q2531/113C12Q2563/107
Inventor 唐松青张英丹陈子豪田仁云王罗玲万梦雨朱海珍
Owner HUNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com