Application of ZmELF3.1 protein and function deletion mutant thereof in regulation and control of crop tassel branch number

A technology of protein function and branch number, which can be used in applications, plant peptides, plant products, etc., and can solve the problem of no corn tassel branch number.

Active Publication Date: 2021-12-24
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on the specific genes that specifically control the number of tassel branches in maize, and there is no report about the regulation of ELF3 on the number of tassel branches in maize.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ZmELF3.1 protein and function deletion mutant thereof in regulation and control of crop tassel branch number
  • Application of ZmELF3.1 protein and function deletion mutant thereof in regulation and control of crop tassel branch number
  • Application of ZmELF3.1 protein and function deletion mutant thereof in regulation and control of crop tassel branch number

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Acquisition of ZmELF3.1 Gene and Creation of Mutant zmelf3.1

[0049] 1. Acquisition of ZmELF3.1 gene

[0050] In this experiment, based on the protein sequence of Arabidopsis ELF3, two maize ELF3 genes were obtained through homologous comparison in the maize genome database, named ZmELF3.1 and ZmELF3.2 respectively.

[0051] 2. Creation of mutant Zmelf3.1

[0052] First, obtain the genome sequence of ZmELF3.1 (Zm00001d044232) from the corn Gramene database, and mark out the CDS sequence in the genome sequence, and then design two target sites in the CDS sequence with Snap Gene Viewer software. After the target site is found To perform BLAST comparison to the Gramene corn database to ensure the specificity of these two target loci. The target sequences are:

[0053] ZmELF3.1-Guide 1: GTCCTCACAGACCAAGAACA AGG

[0054] ZmELF3.1-Guide 2: GTAGACTGTCGATAAAATCT AGG

[0055] Genomic DNA of wild-type maize inbred line C01 was extracted by CTAB method. Use pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a ZmELF3.1 protein and a function deletion mutant thereof in regulation and control of a Zea mays L. tassel branch number. On the basis of the protein sequence of Arabidopsis thaliana ELF3, the ELF3 genes of two pieces of Zea mays L. are obtained through homologous comparison in a Zea mays L. genome database, wherein the two ELF3 genes are respectively named as ZmELF3.1 and ZmELF3.2. After the Zea mays L. ZmELF3.1 gene is mutated by further utilizing an RISPR / Cas9 gene editing technology, the function deletion mutant of the Zea mays L. ZmELF3.1 gene shows a phenotype that the tassel branch number is increased under long-day and short-day conditions, and therefore, a situation that the Zea mays L. ZmELF3.1 gene plays a crucial role in the regulation and control of the increase of the Zea mays L. tassel branch number is determined. The invention has an application prospect in the regulation and control of the increase of the Zea mays L. tassel branch number, and also can be applied to Zea mays L. inbred line improvement and cross breeding.

Description

technical field [0001] The present invention relates to the new application of ZmELF3.1 protein and its function loss mutant, especially the application of ZmELF3.1 protein and its function loss mutant in regulating the number of tassel branches of crops, belonging to ZmELF3.1 functional protein and its mutant new areas of use. Background technique [0002] Corn is the grain crop with the largest planting area in the world, an important feed and industrial raw material, and it is also the largest grain crop in my country. The increase and stability of its production directly affect the security of food supply in my country. Maize is a monoecious cross-pollinated crop. The tassel is located at the top of the plant, and the ear grows in the middle of the plant, which is convenient for receiving pollen. The number of tassel branches in maize is an important part of tassel traits. The number of tassel branches is closely related to the size of maize tassels. The more tassel bra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84C12N15/55C12N15/29A01H5/02A01H6/46
CPCC12N15/8218C12N15/827C12N15/8205C12N9/22C07K14/415Y02A40/146
Inventor谢钰容王海洋王宝宝赵永平
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI