Laboratory diagnosis blood marker for liver fibrosis caused by hepatitis B virus

A hepatitis B virus, laboratory diagnosis technology, applied in the field of diagnostics, can solve problems such as application limitations, and achieve the effect of excellent diagnostic value

Active Publication Date: 2022-01-18
QINGDAO BLOOD CENT
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this approach is invasive, so its clinical application has been limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Laboratory diagnosis blood marker for liver fibrosis caused by hepatitis B virus
  • Laboratory diagnosis blood marker for liver fibrosis caused by hepatitis B virus
  • Laboratory diagnosis blood marker for liver fibrosis caused by hepatitis B virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] (1) Select the 25 cases and 75 healthy patients suffering from hepatitis B patients, classified according to the results FibroScan

[0023] .. A. healthy control group, B group with mild to moderate fibrosis patients (n = 25), C severe liver fibrosis patients (n = 25), D early cirrhosis patients (25 cases).;

[0024] Patients Inclusion criteria: patient HBsAg and (or) HBV DNA positive for more than 6 months, now HBsAg positive and / or HBV DNA still positive; decompensated cirrhosis not entered, no tumor, no liver surgery, without anti history of viral therapy; patients aged 18-80 years, BMI less than equal to 28kg / m 2 .

[0025] Exclusion criteria: combined with other types of viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease, autoimmune liver disease, AIDS, liver hydatid, drug-induced liver injury such as liver disease; the presence of decompensated cirrhosis, liver tumor or other neoplastic diseases; associated with liver fibrosis-related basic...

Embodiment 2

[0034] CDNA synthesized by reverse transcription

[0035] (1) arranged according to the following reaction system and the amount of reagent on ice:

[0036] Reagent name Usage amount 5 × GDNA ERASER BUFFER 2.0μL GDNA ERASER 1.0μL Total RNA 1.0ug RNASE FREE DH 2 O

[0037] (2) configure the reaction system, after heating 42 ℃ 2min, placed in temporary storage. 4 deg.] C;

[0038] (3) arranged according to the following reaction system and the amount of reagent on ice:

[0039] Reagent name Usage amount Step (1) reaction liquid 10.0μL 5 × primescript buffer 2 4.0μL Primescript RT Enzyme Mix i 1.0μL Rt Primer Mix 1.0μL RNASE FREE DH 2 O

[0040] (4) configured reaction system, 37 ℃ heating 15min, heated 5s after 85 ℃, placed in temporary storage 4 deg.] C.

Embodiment 3

[0042] Detecting the relative expression of each group LOC107984588

[0043] (1) Configuration of the reaction system and reagents used in the following amounts:

[0044] Reagent name Usage amount Sybr Green Premix EX TAQTM (2 ×) 10μL Upstream primer 0.4μL Downstream primer 0.4μL CDNA template 2μL DDH 2 O

7.2μL Total 20μL

[0045] The LOC107984588 sequence (see SEQ ID NO.1) Primer design:

[0046] LOC107984588 upstream primer sequence is: GAACCCTTCGCTTGGCAAAC, SEQ ID NO.2;

[0047] LOC107984588 downstream primer sequences: CTTAGCGGCTAAGCGTGAGT, SEQ ID NO.3;

[0048] The reaction conditions for PCR: 95 ℃ 10min, 1 cycle; 95 ℃ 20s, 60 ℃ 40s, 38 cycles; 60 ℃ 5min.

[0049] (2) 2 -△△Ct PCR methods for processing the data obtained, the results obtained are plotted chart.

[0050] Experimental results figure 1 , The relative expression of the group B LOC107984588 was 1.48 ± 0.37, Group C relative expression LOC107984588 was 1.75 ± 0.54, the r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a laboratory diagnosis blood marker for liver fibrosis caused by hepatitis B virus, and belongs to the technical field of diagnostics. The marker provided by the invention is highly expressed in plasma of a patient with liver fibrosis, and the expression level is related to the severity of liver fibrosis. The marker has excellent diagnostic value when used for detection, so that early diagnosis and early treatment of hepatitis B liver fibrosis are realized.

Description

Technical field [0001] The present invention belongs to the technical field of diagnostics, in particular, it relates to one kind of liver fibrosis caused by hepatitis B virus laboratory diagnostic blood markers. Background technique [0002] Liver fibrosis is common pathological basis for the development of chronic liver disease condition for various reasons, but the early stages of liver fibrosis and cirrhosis the only way. Many causes of liver fibrosis, in our country, the leading cause of liver fibrosis in hepatitis B virus. China is a big country of hepatitis, viral hepatitis number of carriers reached 130 million, of which about 30 million hepatitis B patients, and therefore, accurate diagnosis of hepatitis B fibrosis and fibrosis plays an important distinction between hepatitis B patients for early treatment significance of early diagnosis can improve patient outcomes and improve the quality of life of patients. [0003] Currently, the main way to diagnose liver fibrosis i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12N15/11C12Q2600/158Y02A50/30
Inventor马维娟杨忠思许雷
OwnerQINGDAO BLOOD CENT