Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor

A technology of gene inhibition and proliferation inhibition, applied in the field of tumor cell biology, can solve the complex problems of colorectal cancer, and achieve excellent diagnostic value and the effect of inhibiting proliferation

Active Publication Date: 2022-05-24
广东齐美生命医学技术研究院 +3
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although many studies have found that various factors play an important role in the pathogenesis of colorectal cancer, the occurrence and evolution of colorectal cancer is an intricate regulatory process, and there are still many problems that need further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor
  • Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor
  • Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Detection of the expression difference of AC092635.1 gene in colorectal tumor tissue and adjacent tissue

[0037] 1. Extracting RNA from Tissue

[0038] (1) Put 50 mg of colorectal cancer tissue and paracancerous tissue into a pre-cooled mortar and quickly grind into powder;

[0039] (2) Add 1ml Trizol to the mortar, mix well and transfer it to an enzyme-free centrifuge tube, and let it stand at room temperature for 5 minutes;

[0040] (3) Set the speed of the centrifuge to 12000rpm, put it into the centrifuge tube and centrifuge for 5min;

[0041] (4) Add 200 μl of chloroform to the centrifuge tube, invert and mix, and let it stand at room temperature for 10 minutes;

[0042] (5) Set the speed of the centrifuge to 12000rpm, put it into the centrifuge tube and centrifuge for 10min;

[0043] (6) Divide the liquid into three layers, transfer the supernatant of the upper layer to a new non-enzyme centrifuge tube, add an equal volume of pre-cooled isopropanol, mix well, ...

Embodiment 2

[0073] Detection of differential expression of AC092635.1 in colorectal cancer cells by real-time PCR

[0074] (1) Human normal colon epithelial cells NCM460 and HT29, SW620, SW480 and LOVO in logarithmic growth phase were inoculated in cell culture plates;

[0075] (2) After the cell density reaches 90%, add Trizol to extract RNA, RNA extraction, reverse transcription reaction and fluorescence quantitative PCR reaction steps are the same as those in Example 1.

[0076] The differences in the expression of AC092635.1 in different colorectal cancer cells are as follows: Figure 5 shown. It can be seen that the expression level of AC092635.1 in colorectal cancer cells is significantly higher than that in human normal colon epithelial cells NCM460, which is consistent with the expression level in tissues.

Embodiment 3

[0078] Design the interfering RNA of AC092635.1 and verify the interference effect

[0079] (1) Design siRNA according to the sequence of AC092635.1 gene ENST00000434509.1, the sequence of si AC092635.1 is as follows:

[0080] Sense strand: AAUUUUCCCCCCUUUCUGUGGG, SEQ ID NO.6

[0081] Antisense strand: CACAGAAAGGGGGGAAAAUUAG, SEQ ID NO.7;

[0082] (2) SW480 cells were seeded in 6-well plates. When the cells grew to 80%, siNC and siAC092635.1 were transfected according to the instructions of LipoFiterTM 3.0. After 48 hours of transfection, RNA was extracted for quantitative PCR detection. For specific steps, see Implementation example 1.

[0083] The knockdown effect of siAC092635.1 is as follows Image 6 As shown, the relative expression of AC092635.1 in siAC092635.1 group cells was (27.30±6.02)%, and it can be seen that siAC092635.1 can effectively inhibit the expression of AC092635.1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a gene preparation in preparation of a colorectal cancer cell proliferation and metastasis inhibitor, and belongs to the technical field of tumor cell biology. The gene inhibitor provided by the invention is a gene inhibitor of an AC092635.1 gene, and the inhibitor can effectively inhibit proliferation, migration, invasion and EMT transformation of colorectal cancer cells, so that the inhibitor can be used for preparing a colorectal cancer cell proliferation and metastasis inhibitor.

Description

[0001] This case is a divisional application. The name of the invention of the original application is a colorectal cancer targeted therapy drug. The application date of the original application is: 2021-02-08, and the application number of the original application is: CN202110184373.9. technical field [0002] The invention belongs to the technical field of tumor cell biology, in particular to the application of a gene preparation in the preparation of colorectal cancer cell proliferation and metastasis inhibitors. Background technique [0003] Colorectal cancer is the most common malignant tumor in the digestive system, and colorectal cancer has the characteristics of high morbidity and high mortality. Currently, colorectal cancer has become the third most common malignant tumor in the world. The current main treatment methods for colorectal cancer are endoscopic resection, surgery, neoadjuvant chemotherapy, adjuvant chemotherapy, radiotherapy and targeted therapy. The fi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/715A61P35/00A61P35/04
CPCA61P35/00A61P35/04A61K31/715Y02A50/30
Inventor 不公告发明人
Owner 广东齐美生命医学技术研究院
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More