Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor
A technology of gene inhibition and proliferation inhibition, applied in the field of tumor cell biology, can solve the complex problems of colorectal cancer, and achieve excellent diagnostic value and the effect of inhibiting proliferation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Detection of the expression difference of AC092635.1 gene in colorectal tumor tissue and adjacent tissue
[0037] 1. Extracting RNA from Tissue
[0038] (1) Put 50 mg of colorectal cancer tissue and paracancerous tissue into a pre-cooled mortar and quickly grind into powder;
[0039] (2) Add 1ml Trizol to the mortar, mix well and transfer it to an enzyme-free centrifuge tube, and let it stand at room temperature for 5 minutes;
[0040] (3) Set the speed of the centrifuge to 12000rpm, put it into the centrifuge tube and centrifuge for 5min;
[0041] (4) Add 200 μl of chloroform to the centrifuge tube, invert and mix, and let it stand at room temperature for 10 minutes;
[0042] (5) Set the speed of the centrifuge to 12000rpm, put it into the centrifuge tube and centrifuge for 10min;
[0043] (6) Divide the liquid into three layers, transfer the supernatant of the upper layer to a new non-enzyme centrifuge tube, add an equal volume of pre-cooled isopropanol, mix well, ...
Embodiment 2
[0073] Detection of differential expression of AC092635.1 in colorectal cancer cells by real-time PCR
[0074] (1) Human normal colon epithelial cells NCM460 and HT29, SW620, SW480 and LOVO in logarithmic growth phase were inoculated in cell culture plates;
[0075] (2) After the cell density reaches 90%, add Trizol to extract RNA, RNA extraction, reverse transcription reaction and fluorescence quantitative PCR reaction steps are the same as those in Example 1.
[0076] The differences in the expression of AC092635.1 in different colorectal cancer cells are as follows: Figure 5 shown. It can be seen that the expression level of AC092635.1 in colorectal cancer cells is significantly higher than that in human normal colon epithelial cells NCM460, which is consistent with the expression level in tissues.
Embodiment 3
[0078] Design the interfering RNA of AC092635.1 and verify the interference effect
[0079] (1) Design siRNA according to the sequence of AC092635.1 gene ENST00000434509.1, the sequence of si AC092635.1 is as follows:
[0080] Sense strand: AAUUUUCCCCCCUUUCUGUGGG, SEQ ID NO.6
[0081] Antisense strand: CACAGAAAGGGGGGAAAAUUAG, SEQ ID NO.7;
[0082] (2) SW480 cells were seeded in 6-well plates. When the cells grew to 80%, siNC and siAC092635.1 were transfected according to the instructions of LipoFiterTM 3.0. After 48 hours of transfection, RNA was extracted for quantitative PCR detection. For specific steps, see Implementation example 1.
[0083] The knockdown effect of siAC092635.1 is as follows Image 6 As shown, the relative expression of AC092635.1 in siAC092635.1 group cells was (27.30±6.02)%, and it can be seen that siAC092635.1 can effectively inhibit the expression of AC092635.1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


