Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of lymphocyte combined with nano-composite mediating CRISPR system in preparation of medicines for treatment of cervical cancer

A technology of nanocomposites and lymphocytes, which is applied in the direction of nanomedicine, drug combination, gene therapy, etc., can solve the problem that the response rate of immunotherapy is less than 30%, and achieve the effect of good application prospects

Pending Publication Date: 2022-01-21
ARMY MEDICAL UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cervical cancer immunotherapy provides an opportunity for advanced recurrence and metastasis of cervical cancer, but the response rate of PD1, CTLA-4 and other immunotherapy is less than 30%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lymphocyte combined with nano-composite mediating CRISPR system in preparation of medicines for treatment of cervical cancer
  • Application of lymphocyte combined with nano-composite mediating CRISPR system in preparation of medicines for treatment of cervical cancer
  • Application of lymphocyte combined with nano-composite mediating CRISPR system in preparation of medicines for treatment of cervical cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] CRISPR / Cas9 vector construction and mRNA transcription in vitro

[0035] For the target gene sequence, sgRNA is designed, and single-stranded oligo is synthesized by American Cyagen Company. Construct the sgRNA+CRISPR / Cas9 overexpression plasmid, as well as the corresponding sgRNA and P330X plasmid vectors for in vitro transcription of mRNA. The sgRNA+CRISPR / Cas9 overexpression plasmid was transfected into HeLa cells, the HPVE6 / E7 gene cutting effect of the plasmid was verified by Sanger sequencing, and the mRNA was transcribed in vitro after verification. The sgRNA is as follows:

[0036] E6: GAAGCTACCTGATCTGTGCA

[0037] E7: GGAGCAATTAAGCGACTCAG

[0038] Chemical modification of in vitro transcribed mRNA such as figure 1 As shown, using The MessageMAX TM T7 ARCA-CappedMessage Transcription Kit transcription kit, which transcribes Cas and sgRNA into mRNA in vitro. Using T7 RNA polymerase and anti-reverse cap analog (ARCA) m27,3'-OG [5'] ppp [5'] chemical modifi...

Embodiment 2

[0041] Preparation and Characterization of pH Responsive Nanoparticles (ACD NPs)

[0042] (1) Preparation of ACD (acetalized β-cyclodextrin)

[0043] 1g of β-CD was ultrasonically dissolved in 10mL of anhydrous DMSO, and magnetically stirred at 25°C for 5min. Then add 4.5mL diethoxypropylene, 16.3mg pyridinium p-toluenesulfonate (PTS), magnetically stir at room temperature to fully dissolve the PTS, then add 4mL methoxypropylene (MP), react at room temperature for 3 hours, add 0.2 mL of triethylamine was used to terminate the reaction. 200mL of pure water was poured into the obtained solution, precipitated by deionized water, and the reaction product was precipitated, washed 5 times with 14000rpm centrifugal water until the solution became clear, and the ACD solution was obtained, and the obtained product was lyophilized in a vacuum freeze dryer for use.

[0044] (2) Preparation of pH-responsive nanoparticles

[0045] CRISPR-Cas9 and sgRNA(E6) / sgRNA(E7) were configured at a...

Embodiment 3

[0054] Immunomodulatory effect of E6 / ACD NP in mouse HeLa xenografts

[0055] Lymphocytes were isolated from fresh human umbilical cord blood using Ficoll-Paque Premium (Pharmacia Ltd., Sweden), counted and mixed with PBS. Nude mice were subcutaneously injected with HeLa cells (2×10 7 ) to establish HeLa xenografts. To test the presence of an immunosuppressive tumor microenvironment, mice were intratumorally injected with ACD NP on day 15 after injection of HeLa cells. The mice were then randomly divided into two groups. One group of mice was injected with normal saline, and the other group of mice were injected with freshly isolated lymphocytes (1.5-2×10 7 ). Five days after the last treatment, the tumors were resected, and the counts of CD45+ or CD8+ T cells were detected by flow cytometry.

[0056] To study the effect of E6 / ACD NP treatment on the tumor microenvironment. In this case, HeLa-transplanted mice were topically injected with ACD NP or E6 / ACD NP on day 15 af...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of lymphocyte combined with a gene editing-based nano-composite mediating a CRISPR system in preparation of medicines for treatment of cervical cancer, and belongs to the technical field of medicines. According to the invention, a Cas9 mRNA and guide RNA simultaneous delivery strategy is adopted, and a CRISPR / Cas9 nano-delivery system with better transfection efficiency is successfully constructed, so that a new attempt is provided for research and development of non-viral vectors, and the constructed pH-responsive cyclodextrin nano-compound has low pH value targeting characteristic and endogenous escape mechanism, so that nano-particles can be released locally in tumors, and the in-vivo transportation effect can be achieved to the maximum extent. Meanwhile, since the immunosuppressive microenvironment of the cervical cancer is complex, the combined application of the lymphocyte with the gene editing-based nano-composite for the treatment of cervical cancer can remodel the local immune environment at the local part of the tumor, thus playing the anti-tumor effect to the maximum extent.

Description

technical field [0001] The invention belongs to the technical field of medicine, and in particular relates to the application of lymphocyte co-mediated CRISPR / Case9 nanometer gene editing system in the preparation of drugs for treating cervical cancer. Background technique [0002] Cervical cancer screening technology has been implemented in my country for many years, and measures such as free census have also been implemented at the national level. However, in recent years, there are still nearly 110,000 new cases of cervical cancer in China and nearly 60,000 deaths each year. The total number of deaths is 18.3% and 17.6%, and the cervical cancer patients in my country account for about 1 / 5 of the world's total. The pressure of prevention and control is very high. Human papillomavirus (HPV) is the most important risk factor and culprit of the disease. The recurrence rate of locally advanced cervical cancer is high, and the late survival rate is worrying. Advanced recurrenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P35/00A61P37/04A61K35/17B82Y5/00
CPCA61K48/0058A61K35/17A61P35/00A61P37/04A61K48/0041B82Y5/00
Inventor 凌开建梁志清张建祥窦寅王延洲
Owner ARMY MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More