Soybean nuclear male sterility InDel marker and application thereof

A male sterility and cell nucleus technology, applied in the field of genetic breeding, can solve the problems of cumbersome operation, high cost, and long time-consuming CAPS labeling, and achieve the effects of good stability, low cost, and improved screening efficiency and screening accuracy

Pending Publication Date: 2022-03-11
ANHUI AGRICULTURAL UNIVERSITY +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, CAPS marking still has the disadvantages of time-consuming, high cost and cumbersome operation
The fertility of soybean plants plays an important role in the development of soybean breeding, but there is no molecular biological method reported in the prior art that can effectively judge whether soybean plants are fertile

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean nuclear male sterility InDel marker and application thereof
  • Soybean nuclear male sterility InDel marker and application thereof
  • Soybean nuclear male sterility InDel marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] like figure 1 As shown, a soybean natural male sterile plant found in the field was used in 2013 to cross with other soybean varieties to construct a sterile population. Hybrids were planted and harvested in 2014. Then the seeds of the harvested F1 generation were planted in the experimental site to obtain the F2 population. Then, from 2016 to 2019, the population was bred continuously and planted in the high-tech industrial park of Anhui Agricultural University.

[0033] In the present embodiment, the above-mentioned F2 population was analyzed genetically, and the shape survey and statistics of 892 soybean plants in the F2 sterile population were carried out. It was found that there were 694 sterile plants and 198 fertile plants, which were obtained by using SPSS12.0 software. The chi-square test separation ratio of the data conforms to the ratio of 3:1, as shown in Table 1, χ 2 3:1 2 0.05 =3.841, indicating that the sterility trait of this population is controlle...

Embodiment 2

[0044] Using the above-mentioned InDel markers to identify the male fertility of soybean plant nuclei, first design primer pairs at both ends of the missing chromosome segment of chromosome 13 as follows:

[0045] 1F: TGCCACTAACACCATCGACA SEQ ID NO.2

[0046] 1R: ACTCATGCGGTTTGTGGGAG SEQ ID NO.3

[0047] Then design a pair of primers based on the non-deleted fragment Gm200 gene of soybean fertile plants for its identification. The sequence of the primers is as follows:

[0048] 2F: TAAACCTCGTCGTCGTTCATT SEQ ID NO.4

[0049] 2R: CTGCTAGTCTGCCCATACGC SEQ ID NO. 5

[0050] In order to realize rapid detection and identification of the fertility of soybean plants, in the present embodiment, the above-mentioned two pairs of primers are used to jointly perform PCR amplification on multiple sets of extracted soybean genomic DNA to be tested;

[0051] The PCR amplification system is: 2.0 μL of 100ng / μL template DNA, 1.0 μL of 10 μM primers, 1.0U KODone enzyme 12.5 μL, ddH 2 O 8.5 μ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic breeding, in particular to an InDel marker remarkably related to soybean cell nucleus male sterility, application of the InDel marker and a method for identifying soybean plant fertility by using the InDel marker. The InDel marker is located between 22776268bp and 222815034bp of the No.13 chromosome of the soybean, the InDel marker can be used for rapidly identifying the nuclear male sterile plant of the soybean plant, meanwhile, the screening time is shortened, and the screening efficiency and the screening accuracy are improved.

Description

[0001] This application claims the priority of the application number 202110426981.6 filed on April 20, 2021, "A Method for Soybean Nuclear Male Sterility InDel Marking and Creating a Male Sterile Line", and the original acceptance institution is China. technical field [0002] The invention relates to the technical field of genetic breeding, in particular to an InDel marker significantly related to soybean nuclear male sterility and its application and a method for identifying soybean plant fertility using the InDel marker. [0003] technical background [0004] Soybean is one of the most important economic crops in the world. It is rich in nutrients, with a protein content of about 40%, which is significantly higher than that of other major crops, and an oil content of about 20%. Soybean also contains many essential nutrients such as soy isoflavones and dietary fiber. But at present, the low yield of soybeans in China is still a problem that the soybean industry urgently ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
CPCC12Q1/6895C12Q1/686C12Q2600/156C12Q2600/13C07K14/415C12N15/113C12N15/8218C12N15/8289C12N2310/20
Inventor王晓波邱丽娟程安东李佳佳赵夺张文明
OwnerANHUI AGRICULTURAL UNIVERSITY