Vitamin D3 C-25 site P450 hydroxylase as well as gene, expression vector, strain and application thereof
A D3C-25, expression vector technology, applied in the field of enzyme engineering, can solve the problems of low yield, high production cost, low purity, etc., and achieve the effects of reducing production cost, high specificity, and reducing reaction by-products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Metagenome Screening
[0032] Based on metagenomic technology, soil samples were collected in the soil buried with vitamin D3 in advance, and the total DNA of the sample was extracted with a soil genome extraction kit, which was used as a template for metagenomic DNA. Design degenerate primers based on the conserved sequence of P450 enzymes and carry out PCR amplification to screen the target P450 enzyme gene, and then further design primers according to the sequencing results to amplify the complete gene coding sequence by PCR technology. The amplified fragments were sequenced and compared with the NCBI database. Based on the results, primers were further designed to amplify the complete vitamin D3 C-25 hydroxylation P450 enzyme gene coding sequence, which was named vitamin D3C-25 hydroxylation P450 enzyme CYP109E1 -H and its gene sequence cyp109E1-H.
Embodiment 2
[0033] Example 2 Construction of Bacillus subtilis WB600-pMA5-CYP109E1-H
[0034] (1) Cloning of vitamin D3 C-25 P450 hydroxylase CYP109E1-H and its gene sequence cyp109E1-H
[0035] In the early stage, the relevant vitamin D3 C-25 P450 hydroxylase CYP109E1-H and its gene sequence cyp109E1-H were obtained through metagenomic screening, and primers were designed to amplify the target gene. The primer sequence is as follows:
[0036] Primer F:
[0037] AAAAGGAGCGATTTACATATGATGAAAACAGAAAGAGAAAACGGAA;
[0038] Primer R:
[0039] GAGCTCGACTCTAGAGGATCCTTATACGTTTTTACGAATCAATAATTCTTT
[0040] The obtained DNA sequence is used as a template, and the above nucleotide sequence is used as a primer to amplify vitamin D3 C-25 P450 hydroxylase CYP109E1-H and its gene sequence cyp109E1-H by PCR. The PCR reaction was carried out in a 50 μL system, and the reaction conditions were as follows: 3 minutes of pre-denaturation at 95°C followed by cycling; denaturation at 95°C for 30 s, annealing...
Embodiment 3
[0047] Example 3 Optimum temperature of vitamin D3 C-25 P450 hydroxylase CYP109E1-H
[0048] Whole cell transformation was carried out at 30° C. and 37° C. for 72 hours, and other conditions were the same as in Example 2. Calcidiol 25(OH)VD 3 The output is shown in the table below.
[0049]
[0050] It can be seen from the above table that the optimal catalytic temperature of vitamin D3 C-25 P450 hydroxylase CYP109E1-H is 30°C.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap