Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection kit for fragile X syndrome

A detection kit and syndrome technology, applied in the field of biochemistry, can solve the problems of low detection accuracy, large amount of DNA, high cost, etc., and achieve the effect of simple operation, small sample size and easy operation

Pending Publication Date: 2022-04-22
广州源古纪科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Southern blot is the main method for diagnosis, but it may miss the diagnosis of carriers or chimeras with a small number of CGG repeats, and it may be misdiagnosed when the enzymatic digestion is incomplete
Moreover, this method is expensive, time-consuming and laborious, requires a large amount of DNA, has radioactive hazards, and is not suitable for large-scale screening at the grassroots level
[0007] Conventional PCR detection, the detection method is complicated, there are many steps, and the detection accuracy is low, and the clinical reference is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] This example prepared the Fragile X syndrome detection kit of the present invention

[0022] A fragile X syndrome detection kit, including primer set, PCR reaction solution, Taq enzyme, fragile X syndrome standard substance, negative control sample; wherein the first primer pair: including the mid-upstream primer FMR1-F1 sequence comprising SEQ ID NO : 1, the downstream primer FMR1-R1 sequence comprises SEQ ID NO: 2; said SEQ ID NO: 1 is AGCTTCGGCTACAGTCAGGCGCTCAG; SEQ ID NO: 2 is AGCTTCTCCATCGGCTCTTCAGC. Wherein the upstream primers for the CGG repeat sequence in the first primer combination are FMR1-T1 and FMR1-CGG7, the FMR1-T1 sequence comprises SEQ ID NO: 3, and the FMR1-CGG7 sequence comprises SEQ ID NO: 4; the downstream primer is FMR1-R2, Its sequence comprises SEQ ID NO: 5; wherein SEQ ID NO: 3 is CAGGAAACAGCTATGATTGTGCCG; wherein SEQ ID NO: 4 is CAGGATTCAGCTATGACCGTGCCGCGGCGGCGGCGGCGGCGGCGG; SEQ ID NO: 5 is ATGGCTATGCGTAGTTTCTGGGTC. Wherein the upstream prime...

Embodiment 2

[0026] In this embodiment, the assay of the sample is performed with respect to the kit of Embodiment 1.

[0027] Use a commercially available genomic DNA extraction kit to extract genomic DNA from the peripheral blood of the sample, with a concentration of at least 60 ng / μL, a 260 / 230 value greater than 2.0, and a 260 / 280 value greater than 1.8.

[0028] PCR system I reaction system prepared using the kit in Example 1: prepare 20 μL PCR system in a 200 μL PCR thin-walled tube.

[0029] The PCR reaction system is as follows:

[0030] components content 10×PCR buffer 2μl MgCl 2 (25mmol / L)

2μl dNTP (10mmol / L) 0.4μl FMR1-F1 (10μmol / L) 1μl FMR1-R1 (10μmol / L) 1μl DNA polymerase 0.1μl dna 1μl 2×PCR enhancer 10μl double distilled water Make up 20μl

[0031] PCR amplification program: pre-denaturation at 97°C for 5min; denaturation at 98°C for 40s, annealing at 65°C for 35s, extension at 72°C for 4min, 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fragile X syndrome detection kit, which achieves the effects of high detection speed and high accuracy. According to the technical scheme, the fragile X syndrome detection kit is provided and comprises a primer group, PCR reaction liquid, Taq enzyme, a fragile X syndrome standard substance and a negative control sample; the primer group comprises a first primer pair for amplifying a region containing a CGG repeated region, a 5'flanking region and a 3 'flanking region, a first primer combination for amplifying the region containing the CGG repeated region and the 5' flanking region, and a second primer combination for amplifying the region containing the CGG repeated region and the 3 'flanking region. The kit disclosed by the invention is used for rapidly screening the CGG repetition number of the fragile X syndrome site FMR1 in a large sample size including male and female, and the method can be applied to fragile X genetic detection, prenatal diagnosis and pre-embryo implantation diagnosis. The kit has the advantages of rapidness, high throughput, small sample size, low price, simplicity in operation and easiness in use.

Description

technical field [0001] The invention relates to the technical field of biochemistry, in particular to a detection kit for fragile X syndrome. Background technique [0002] Fragile X syndrome (fragile X syndrome, FXS) is one of the most common inherited mental retardation diseases, with an incidence of about 1 / 4000 males and 1 / 6000 females (1 / 5000-1 / 8000). second only to Down syndrome. The molecular genetic basis of Fragile X syndrome is the 5' untranslated region (CGG) n trinucleotide repeat of Fragile Xmental retardation gene 1 (Fragile Xmental retardation gene 1, FMR1, OMIM: 309550, located at Xq27.3) Aberrant sequence amplification and methylation of CpG islands in the promoter region, but the relationship between the two is not yet clear. More than 95% of FXS patients are caused by the CGG repeat mechanism, and less than 5% of FXS patients are caused by missense mutations and deletion mutations of the FMR1 gene that affect the normal structure and function of FMRP, res...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/113C12Q2525/151C12Q2565/125
Inventor 段志峰
Owner 广州源古纪科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More