Detection kit for fragile X syndrome
A detection kit and syndrome technology, applied in the field of biochemistry, can solve the problems of low detection accuracy, large amount of DNA, high cost, etc., and achieve the effect of simple operation, small sample size and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] This example prepared the Fragile X syndrome detection kit of the present invention
[0022] A fragile X syndrome detection kit, including primer set, PCR reaction solution, Taq enzyme, fragile X syndrome standard substance, negative control sample; wherein the first primer pair: including the mid-upstream primer FMR1-F1 sequence comprising SEQ ID NO : 1, the downstream primer FMR1-R1 sequence comprises SEQ ID NO: 2; said SEQ ID NO: 1 is AGCTTCGGCTACAGTCAGGCGCTCAG; SEQ ID NO: 2 is AGCTTCTCCATCGGCTCTTCAGC. Wherein the upstream primers for the CGG repeat sequence in the first primer combination are FMR1-T1 and FMR1-CGG7, the FMR1-T1 sequence comprises SEQ ID NO: 3, and the FMR1-CGG7 sequence comprises SEQ ID NO: 4; the downstream primer is FMR1-R2, Its sequence comprises SEQ ID NO: 5; wherein SEQ ID NO: 3 is CAGGAAACAGCTATGATTGTGCCG; wherein SEQ ID NO: 4 is CAGGATTCAGCTATGACCGTGCCGCGGCGGCGGCGGCGGCGGCGG; SEQ ID NO: 5 is ATGGCTATGCGTAGTTTCTGGGTC. Wherein the upstream prime...
Embodiment 2
[0026] In this embodiment, the assay of the sample is performed with respect to the kit of Embodiment 1.
[0027] Use a commercially available genomic DNA extraction kit to extract genomic DNA from the peripheral blood of the sample, with a concentration of at least 60 ng / μL, a 260 / 230 value greater than 2.0, and a 260 / 280 value greater than 1.8.
[0028] PCR system I reaction system prepared using the kit in Example 1: prepare 20 μL PCR system in a 200 μL PCR thin-walled tube.
[0029] The PCR reaction system is as follows:
[0030] components content 10×PCR buffer 2μl MgCl 2 (25mmol / L)
2μl dNTP (10mmol / L) 0.4μl FMR1-F1 (10μmol / L) 1μl FMR1-R1 (10μmol / L) 1μl DNA polymerase 0.1μl dna 1μl 2×PCR enhancer 10μl double distilled water Make up 20μl
[0031] PCR amplification program: pre-denaturation at 97°C for 5min; denaturation at 98°C for 40s, annealing at 65°C for 35s, extension at 72°C for 4min, 10...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More