Zucchini ZYMV virus disease molecular marker and method for identifying zucchini ZYMV virus disease resistance

A molecular marker, zucchini technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the problems of few disease-resistant varieties, long cycle, and mid-way selection of hybrid virus breeding.

Pending Publication Date: 2022-04-22
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, due to the problems of cumbersome operation, poor identification accuracy of traits and easy contamination of other viruses in the identification of resistance through artificial inoculation, it is difficult to transfer resistance traits, and the efficiency of disease-resistant breeding is low and the cycle is long. Easy to fail and other problems, there are few disease-resistant varieties in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zucchini ZYMV virus disease molecular marker and method for identifying zucchini ZYMV virus disease resistance
  • Zucchini ZYMV virus disease molecular marker and method for identifying zucchini ZYMV virus disease resistance
  • Zucchini ZYMV virus disease molecular marker and method for identifying zucchini ZYMV virus disease resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Embodiment 1, the identification of zucchini ZYMV virus disease resistance character

[0086] In this example, primers used to identify or assist in the identification of ZYMV virus disease resistance traits of zucchini are used to identify the resistance traits of ZYMV virus disease of zucchini to A1. A1 is composed of single-stranded DNA named P1 and P2, and P1 is SEQ ID No. The single-stranded DNA represented by positions 1-21 of 1 (P1: 7547962F, TGCACTCCAGAAGATCGTCAT), and P2 is the single-stranded DNA reverse complementary to positions 297-316 of SEQ ID No. 1 (P2: 7547962R, CTGCTTGAGCTTGCTATCCC).

[0087] 1. The zucchini to be identified are as follows, and 50 strains of each zucchini are selected for testing:

[0088] Zucchini inbred line Teizer58, whose phenotype is susceptible to ZYMV virus disease;

[0089] Zucchini inbred line Cucurbita 8 father, whose phenotype is resistant to ZYMV virus disease;

[0090] Ailu No. 1, whose phenotype is susceptible to ZYMV v...

Embodiment 2

[0115] Example 2, the acquisition method of the InDel molecular marker closely linked with the zucchini ZYMV virus disease dominant resistance gene CpZYMV

[0116] The zucchini ZYMV virus disease molecular marker of Example 1 is named molecular marker 7547962, and this embodiment specifically describes the method for obtaining the InDel molecular marker 7547962 closely linked with the zucchini ZYMV virus disease dominant resistance gene CpZYMV, including the following step:

[0117] (1) Zucchini inbred line Cucurbita 8 father and Teizer58F 2 Generation generation and phenotyping:

[0118] (1) Cucurbit inbred line Cucurbita 8 father (female parent, P1) was crossed with Teizer58 (male parent, P2) to obtain hybrid F 1 , F 1 F 2 generation groups.

[0119] (2) 192 strains of F 2The single plant of the generation group was planted in a greenhouse nutrient pot, covered with an insect-proof net, and inoculated with ZYMV virus disease after the cotyledons were fully expanded, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a zucchini ZYMV virus disease molecular marker and a method for identifying zucchini ZYMV virus disease resistance. The polymorphism of the ZYMV virus disease molecular marker is that whether DNA fragments as shown in the 172nd-196th sites in SEQ ID No.1 in a sequence table are deleted in a zucchini genome or not. According to the invention, the molecular marker 7547962 closely linked with the disease-resistant gene is obtained. The obtained molecular marker is used for auxiliary selection, and a disease-resistant gene is successfully introduced into a zucchini excellent inbred line Teizer58 through hybridization and backcross transformation methods, so that the zucchini excellent inbred line Teizer58 obtains ZYMV virus disease resistance.

Description

technical field [0001] The invention relates to a molecular marker of Zucchini ZYMV virus disease and a pair of primers for identifying ZYMV virus disease resistance traits of Zucchini in the field of biotechnology. Background technique [0002] Zucchini (Cucurbita pepo L.) is an important melon vegetable in my country. In recent years, the cultivated area has expanded year by year, and the cultivated area in protected areas is second only to cucumber. It has become an important crop for increasing farmers' income and adjusting agricultural structure. [0003] Zucchini yellow mosaic virus (ZYMV) is one of the main diseases that endanger the production of Cucurbitaceae crops such as zucchini. After the plant is infected with ZYMV, it will produce symptoms such as mosaic and leaves, dwarfing and deformity of the plant, bumpy fruit surface, stiff flesh and bitter taste, which will make the fruit lose its commercial value, resulting in a loss of more than 60% of the yield, and e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12N15/11A01H1/04
CPCC12Q1/6895A01H1/04C12Q2600/13C12Q2600/156
Inventor张国裕李海真张帆田佳星贾长才
OwnerBEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES