Supercharge Your Innovation With Domain-Expert AI Agents!

Mutant RNase R as well as preparation method and application thereof

A mutation-type, site-directed mutation technology, applied in the field of molecular biology, can solve the problems of increasing production costs and loss, and achieve the effect of high protein expression

Active Publication Date: 2022-05-06
GUANGZHOU GENESEED BIOTECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This restriction puts forward higher requirements on the purity of RNA samples, and at the same time increases the cost and loss of RNA preparation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant RNase R as well as preparation method and application thereof
  • Mutant RNase R as well as preparation method and application thereof
  • Mutant RNase R as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The structure of embodiment 1 mutant RNase R expression vector

[0038] The wild-type RNase R (amino acid sequence shown in SEQ.NO.1) of Escherichia coli origin and the RNase R (amino acid sequence shown in SEQ.NO.3) of a salt-tolerant Psychrobacter sp.strain ANT206 origin were carried out amino acid Sequence alignment (alignment results such as figure 1 shown). Determine the amino acid residues that may have an important impact on salt tolerance, and perform truncation mutations on them. The mutated RNase R is named RNase R_△M8, and its amino acid sequence is shown in SEQ.NO.5.

[0039] Primers were designed according to the mutation points, and the primer sequences were as follows:

[0040] RNase R-F: TAACTTTAAGAAGGAGATATACATATGCATCATCATCATCATCATTCACAAG (SEQ. ID NO. 9);

[0041] RNase R_△M8-R: TGCCGGTTTCAGTGGTGTTGCCCTG (SEQ.NO.10);

[0042] RNaseR_ΔM8-F: GCAACACCACTGAAACCGGCATGCTGCAACTGGGTCAGCAC (SEQ. NO.11);

[0043] RNase R-R: TCAGTGGTGGTGGTGGTGGTGCTCGAGTCACTCT...

Embodiment 2

[0049] Example 2 protein expression

[0050] The expression strain RNase R_ΔM8 (BL21(DE3)) obtained in Example 1 was inoculated into 5 mL of LA culture medium, and placed in a shaker at 37° C. at 200 rpm for overnight shaking culture.

[0051] On the next day, inoculate 5 mL of the overnight culture into a new 500 mL LA culture medium, culture on a shaker at 37°C and 200 rpm for 3 hours (OD value about 0.5), add 500 μL IPTG (1M) to the culture medium (final concentration 1 mM), 37 ℃, 200rpm shaker to continue culturing for 3h. The cells were collected by centrifugation at 10000 g for 5 min, and washed once with 5 mL of sterile PBS.

Embodiment 3

[0052] Example 3 protein purification

[0053] Add 40mL balance washing buffer (50mM phosphate, 500mMNaCl, 20mM imidazole, 0.05% Tween 20, 10% Glycerol, pH 8.0) to the cells collected in Example 2, vortex until the cells are fully resuspended, and centrifuge The tube was fixed in an ice-water bath, the ultrasonic probe was inserted into the liquid surface 1-2cm below the liquid surface, ultrasonicated until the bacterial liquid was clear and transparent (75% power, ultrasonic 4s and 6s off, total time 10min), centrifuged at 18000g, 4°C for 60min, and the supernatant solution (i.e. RNase R_△M8 protein lysate) was transferred to a new centrifuge tube.

[0054] Protein purification was performed using a protein purification system (Unique AutoPure, Inscinstech):

[0055] Ni-NTA column purification: After flushing the system pipes and Ni-NTA column (BBI, product number C600792, specification 1mL) with DEPC treated water, equilibrate the column with equilibrium washing buffer. Lo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a mutant RNase R as well as a preparation method and application thereof. The mutant RNase R provided by the invention is named RNase RM8, the amino acid sequence of the mutant RNase R is as shown in SEQ ID NO.5, and the nucleotide sequence for coding the amino acid sequence is as shown in SEQ ID NO.6. The preparation process of the mutant RNase RM8 provided by the invention comprises the processes of carrier construction, carrier conversion, protein induced expression, bacteria collection, protein purification, activity determination and the like. According to the mutant RNase R provided by the invention, the expression yield and the salt tolerance of the RNase R are improved, and diversified RNA sample requirements are favorably met.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a mutant RNase R and its preparation method and application. Background technique [0002] RNase R (Ribonuclease R), with a molecular weight of about 91.4kDa, is a 3'-5' exoribonuclease derived from the RNR superfamily of Escherichia coli, which can gradually cut RNA into two nuclei from the 3'-5' direction nucleotides and trinucleotides. RNase R can digest almost all linear RNA molecules, but it is not easy to digest circular RNA (circRNA), lariat RNA (lariat RNA), and RNA with double-stranded ends. [0003] At present, RNase R is often used in the enrichment and identification of circRNA. High-throughput sequencing is the fastest way to discover circRNAs in large quantities, but traditional whole-transcriptome sequencing can only find circRNAs with high abundance, but is powerless for circRNAs with rare abundance. Adding a step of RNase R digestion (RNase R+) to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/22C12N15/55C12N15/70C12N1/21C12R1/19
CPCC12N9/22C12N15/70Y02A50/30C12N9/88C12Y406/01C12Q1/6806
Inventor 刘明蔡秋杰张婉君张茂雷
Owner GUANGZHOU GENESEED BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com