MiRNA related to ammonium nitrogen response of woody plant and application of miRNA
A technology of woody plants and ammonium nitrogen, applied in the field of genetic engineering breeding, can solve the problems of difficult verification and achieve significant results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] according to figure 1 As shown, this example proposes to obtain miRNA (pc-miR166b) related to ammonium nitrogen response in woody plants and its target gene eukaryotic translation based on small RNA, transcriptome and degradome sequencing technology, combined with bioinformatics joint analysis Initiation factor (eukaryotic translation initiation factor, eIF).
[0074] (1) Experimental plants and sample preparation
[0075] The 2-month-old poplar hydroponic seedlings were used as the source of experimental materials. NH 4 + Processing, the processing time is 10 days. After the treatment, the root system of poplar ash was selected for harvesting. All harvested samples were quickly placed in liquid nitrogen and stored in a -80°C refrigerator for later use.
[0076] After sampling the root samples of Populus argentina in the treatment group and the control group, in order to obtain enough material for further analysis, the samples of 3 plants were evenly mixed as a re...
Embodiment 2
[0085] according to image 3 As shown, this example proposes a method for verifying the correlation between pc-miR166b labeling and ammonium nitrogen treatment, using real-time fluorescent quantitative PCR (qRT-PCR) to perform the expression analysis of the key pc-miR166b and its target gene (eIF) obtained by sequencing. Sample identification.
[0086] (1) Experimental sample preparation
[0087] Take 18 hydroponic seedlings of 2-month-old poplar. Half of them were treated with ammonium nitrogen, and half of them were used as control group. via NH 4 + 10 days after treatment. After harvesting, the roots of poplar ash were quickly frozen in liquid nitrogen. Samples from 3 plants were then evenly mixed as one replicate. Three replicate samples were selected for each group.
[0088] (2) Verification of differential expression of pc-miR166b
[0089] Extraction of total RNA from the root system of Populus cinerea: use RNA extraction kit (TRK1001, Lianchuan Bio, China) to e...
Embodiment 3
[0105] according to Figure 4 As shown, this example proposes the regulation of eIF gene expression in the root of the woody plant poplar and its participation in the response to ammonium nitrogen.
[0106] Construction of pc-miR166b and eIF vectors for transient transformation of tobacco
[0107] Construction of eIF vector: design primers according to the full-length sequence of eIF (Potri.007G119200) gene obtained from the Populus argentica genome database, extract the RNA in the root tissue of P. The long sequence is then recovered and purified, and the target fragment is cloned into the pCAMBIA1300 vector; the specific experimental steps include: obtaining the full-length sequence of the Potri. Click on SpeI and KpnI, and design primers on the TaKaRa website. The primers are (F: ACATTTAAATACTAGTATGATGAAGCCTGGTTCGG;
[0108] R: CCCTTGCTCACCATGTCAGTAACCATTTATCCAATGTCG). Using the root system of Populus argentina as material, total RNAs were extracted using RNA extraction ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com