Unlock instant, AI-driven research and patent intelligence for your innovation.

MiRNA related to ammonium nitrogen response of woody plant and application of miRNA

A technology of woody plants and ammonium nitrogen, applied in the field of genetic engineering breeding, can solve the problems of difficult verification and achieve significant results

Pending Publication Date: 2022-05-10
INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If only through bioinformatics analysis and prediction, a large number of target genes will be obtained, and the verification is extremely difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MiRNA related to ammonium nitrogen response of woody plant and application of miRNA
  • MiRNA related to ammonium nitrogen response of woody plant and application of miRNA
  • MiRNA related to ammonium nitrogen response of woody plant and application of miRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] according to figure 1 As shown, this example proposes to obtain miRNA (pc-miR166b) related to ammonium nitrogen response in woody plants and its target gene eukaryotic translation based on small RNA, transcriptome and degradome sequencing technology, combined with bioinformatics joint analysis Initiation factor (eukaryotic translation initiation factor, eIF).

[0074] (1) Experimental plants and sample preparation

[0075] The 2-month-old poplar hydroponic seedlings were used as the source of experimental materials. NH 4 + Processing, the processing time is 10 days. After the treatment, the root system of poplar ash was selected for harvesting. All harvested samples were quickly placed in liquid nitrogen and stored in a -80°C refrigerator for later use.

[0076] After sampling the root samples of Populus argentina in the treatment group and the control group, in order to obtain enough material for further analysis, the samples of 3 plants were evenly mixed as a re...

Embodiment 2

[0085] according to image 3 As shown, this example proposes a method for verifying the correlation between pc-miR166b labeling and ammonium nitrogen treatment, using real-time fluorescent quantitative PCR (qRT-PCR) to perform the expression analysis of the key pc-miR166b and its target gene (eIF) obtained by sequencing. Sample identification.

[0086] (1) Experimental sample preparation

[0087] Take 18 hydroponic seedlings of 2-month-old poplar. Half of them were treated with ammonium nitrogen, and half of them were used as control group. via NH 4 + 10 days after treatment. After harvesting, the roots of poplar ash were quickly frozen in liquid nitrogen. Samples from 3 plants were then evenly mixed as one replicate. Three replicate samples were selected for each group.

[0088] (2) Verification of differential expression of pc-miR166b

[0089] Extraction of total RNA from the root system of Populus cinerea: use RNA extraction kit (TRK1001, Lianchuan Bio, China) to e...

Embodiment 3

[0105] according to Figure 4 As shown, this example proposes the regulation of eIF gene expression in the root of the woody plant poplar and its participation in the response to ammonium nitrogen.

[0106] Construction of pc-miR166b and eIF vectors for transient transformation of tobacco

[0107] Construction of eIF vector: design primers according to the full-length sequence of eIF (Potri.007G119200) gene obtained from the Populus argentica genome database, extract the RNA in the root tissue of P. The long sequence is then recovered and purified, and the target fragment is cloned into the pCAMBIA1300 vector; the specific experimental steps include: obtaining the full-length sequence of the Potri. Click on SpeI and KpnI, and design primers on the TaKaRa website. The primers are (F: ACATTTAAATACTAGTATGATGAAGCCTGGTTCGG;

[0108] R: CCCTTGCTCACCATGTCAGTAACCATTTATCCAATGTCG). Using the root system of Populus argentina as material, total RNAs were extracted using RNA extraction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses miRNA related to woody plant ammonium nitrogen response and application thereof, the miRNA comprises miRNA, the miRNA is miRNA (pc-miR166b) with up-regulated expression in a woody plant root system under an ammonium nitrogen treatment condition, a target gene of the miRNA is an eukaryotic translation initiation factor (eIF), the miRNA is highly expressed in an ammonium nitrogen treatment process, and by down-regulating the expression of the target gene, the response of the ammonium nitrogen in the woody plant can be reduced, so that the response of the ammonium nitrogen in the woody plant can be reduced, and the response of the ammonium nitrogen in the woody plant can be reduced. The miRNA (pc-miR166b) participates in the response process of the root system of the woody plant to the ammonium nitrogen, the miRNA (pc-miR166b) has good correlation with the response process of the root system of the woody plant to the ammonium nitrogen, and the effectiveness and molecular biology verification shows that the expression quantity of the pc-miR166b has obvious difference between the ammonium nitrogen treatment sample and the control group treatment sample; the method is of great significance to cultivation of novel woody plant germplasm capable of efficiently absorbing and utilizing soil nitrogen, and is suitable for popularization and application.

Description

technical field [0001] The invention relates to a genetic engineering breeding technology, in particular to a miRNA related to ammonium nitrogen response of woody plants and its application. Background technique [0002] Nitrogen is one of the essential macroelements for plant growth and development, and it is also the mineral element that plant roots absorb most from the soil, which is of great significance to its growth and development. However, the content of nitrogen in soil is not uniform, and its distribution in soil space is complex and changeable. How to use the complex and changeable nitrogen environment in soil to develop agriculture and forestry is a major issue that needs to be solved urgently in biological science and technology. Among them, although it is feasible to use traditional breeding methods to breed new species of woody plants with high nitrogen uptake and utilization efficiency, it is difficult to achieve genetically directed improvement and progress ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12Q1/6895C12Q1/6851C12N15/11
CPCC12Q1/6895C12Q1/6851C12N15/8218C12Q2600/158C12Q2600/166C12Q2600/13C12Q2531/113C12Q2525/207C12Q2545/101C12Q2563/107
Inventor 周婧吴江婷
Owner INST OF FORESTRY CHINESE ACAD OF FORESTRY