Method for promoting MTR1 ribozyme catalytic reaction and application of MTR1 ribozyme

A technology for catalyzing reactions and ribozymes, applied in the field of enzyme engineering, can solve problems such as low efficiency and sequence restriction

Active Publication Date: 2022-05-13
SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims to overcome at least one deficiency of the above-mentioned prior art, and provides a method for promoting the catalytic reaction of MTR1 ribozyme and the application of MTR1 ribozyme, which is used to solve the problems of low efficiency and sequence limitation of existing MTR1 methyltransfer ribozyme problem, enabling MTR1 to be more widely used in nucleic acid methylation / alkylation modification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for promoting MTR1 ribozyme catalytic reaction and application of MTR1 ribozyme
  • Method for promoting MTR1 ribozyme catalytic reaction and application of MTR1 ribozyme
  • Method for promoting MTR1 ribozyme catalytic reaction and application of MTR1 ribozyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0138] 1. Crystallization of MTR1

[0139] In this example, the inventors designed a large number of RNA constructs for in vitro transcription, so that in O 6 - crystallized in the presence of methylguanine and obtained RNA crystals containing 69 nucleotides with hairpin loops at the ends of the two helices ( figure 1 B). In this structure, the structure of the core region of the ribozyme remains unchanged. The 5' end of the ribozyme sequence was changed to GCG to improve the accuracy of transcription, while a complementarity change was made to the 3' end of the RNA. In addition, a GAAA loop was added at the end of the P3 helix to facilitate crystallization. Diffraction data collected with a resolution of The structure was solved using anomalous diffraction combined with barium ions. The crystal structure has been deposited in PDB with ID number 7V9B, and the crystallographic statistics are listed in Figure 17 in the table shown.

[0140] 2. The global structure of MT...

Embodiment 2

[0170] 1. MTR1 can be modified by m6A

[0171] Synthetic substrate RNA sequence: m6A14_9A GCGGGGAGACCCGC;

[0172] Design the corresponding MTR1 sequence according to the substrate sequence:

[0173] M_m6A14_9A:

[0174] GCGATAGCGGGTGACCGACCCCCCGAGTTCGCTCGGGGACAACTAGACATACTCCCCGCATA

[0175] Reaction system: substrate RNA 260μM, MTR1 260μM, buffer (120mM KCl, 5mM NaCl and 5mM, Sodium Cacodylate PH6.0), m6G8mM, Mg 2+ 40mM, reacted at 37°C for 9h, separated substrate and enzyme by denaturing polyacrylamide gel electrophoresis after isopropanol precipitation, recovered substrate RNA and carried out Dimroth rearrangement reaction, RNA in 25mM Na 2 CO 3 , pH 10, react in 1mM EDTA at 65°C for 1 hour, and observe by denaturing polyacrylamide gel electrophoresis. In this example, it was observed that m1A was transformed into m6A after the Dimroth rearrangement reaction; as Figure 7 shown.

[0176] 2. RNA fluorescent labeling

[0177] First use Cy3-NHS activated ester, Cy5-NHS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of enzyme engineering, and discloses a method for promoting MTR1 ribozyme catalytic reaction and application of MTR1 ribozyme, and the promotion method comprises the following steps: promoting a proximity effect and / or a directional effect among a substrate RNA, an auxiliary factor O6-methylguanine and MTR1 ribozyme, and promoting general acid catalysis mediated by MTR1 specific site cytosine, so that the MTR1 ribozyme catalytic reaction is promoted, and the MTR1 ribozyme catalytic reaction is promoted. And performing a catalytic reaction in an acid environment, and the like. Through the optimization mode provided by the invention, the problems of low efficiency, sequence limitation and the like of the MTR1 ribozyme are solved. The method not only can efficiently perform sequence-specific methyl / alkylation modification, fluorescence modification and the like on an RNA substrate, but also can perform sequence-specific modification on DNA, so that the application range of MTR1 is wider.

Description

technical field [0001] The invention relates to the technical field of enzyme engineering, more specifically, to a method for promoting the catalytic reaction of MTR1 ribozyme and the application of MTR1 ribozyme. Background technique [0002] The methylation modification of RNA is one of the hottest directions in the field of life science research. Almost all coding and non-coding RNAs undergo post-transcriptional modification, and the vast majority of methylation is S-adenosylmethionine (SAM) as the Universal methyl donor for methylation assembly by a proteinaceous methyltransferase. Both methyltransferases and methylated nucleotides are thought to be evolutionarily very old. [0003] Ribozymes are a class of RNA molecules with catalytic functions that exist in nature and can catalyze a variety of key reactions in RNA, such as the formation of protein amide bonds catalyzed by ribosomes. Chemically diverse ribozymes seem to have disappeared in nature, but active ribozymes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/34C12N15/113
CPCC12P19/34C12N15/113C12N2310/12Y02A50/30
Inventor 黄林邓洁
Owner SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap