Chimeric antigen receptor capable of enhancing anti-tumor capability of CAR-T cell, D-CAR-T cell and application of D-CAR-T cell

A D-CAR-T, chimeric antigen receptor technology, applied in the field of cell therapy

Pending Publication Date: 2022-05-31
AIR FORCE MEDICAL UNIV
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although they are all engineered combinations of different signaling molecular domains, they are still limited to the original domains for reconstruction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor capable of enhancing anti-tumor capability of CAR-T cell, D-CAR-T cell and application of D-CAR-T cell
  • Chimeric antigen receptor capable of enhancing anti-tumor capability of CAR-T cell, D-CAR-T cell and application of D-CAR-T cell
  • Chimeric antigen receptor capable of enhancing anti-tumor capability of CAR-T cell, D-CAR-T cell and application of D-CAR-T cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Zeta-CAR and D-CAR plasmids were successfully constructed using molecular cloning technology, and the specific experimental conditions are as follows.

[0046] Construction and identification of 1Zeta / D-CAR plasmid

[0047] Based on the classic second-generation CD28-CD3ζ-CAR structure, the molecular cloning technology was used to change the CD3ζ molecule containing 3 ITAM motifs into a δ sequence containing only 1 ITAM, and prepared CAR structures with different intracellular signal intensities ( figure 1 ).

[0048] 1.1 Primer design and PCR

[0049] (1) According to the base sequences of Zeta-CAR and D-CAR, Qingke Xinye Biotechnology (Beijing) Co., Ltd. carried out whole gene synthesis, and used this as a template to amplify Zeta respectively using the primers shown in Table 1. -CAR and D-CAR genes:

[0050] Table 1 Amplification Primers

[0051] name Primer sequence (5'-3') Zeta-F GGTACGAATTCGCCACCATGGCACTGCCCGTC (SEQ ID NO: 5) Zeta-R ...

Embodiment 2

[0082] 1 Preparation of CAR-T cells

[0083] 1.1 Cell recovery and subculture

[0084] (1) Take HEK-293T cells out of liquid nitrogen and place them in a 37°C water bath to melt quickly, transfer the cell suspension into a 15mL centrifuge tube in a sterile ultra-clean workbench, add 4-5 times the volume of 10 % fetal bovine serum DMEM complete culture solution, centrifuged at 800 rpm for 5 min, discarded the supernatant, and repeated this step twice to obtain cell pellets.

[0085] (2) Add 5mL of complete culture medium to the cell pellet in step (1), resuspend thoroughly and transfer to a 6cm cell culture dish, place at 37°C, 5% CO 2 cultured in an incubator.

[0086] (3) When the cell density reaches above 80%, 0.05% trypsin can be added to digest the cells. When a small amount of cells fall off the bottom of the dish, immediately add complete culture medium to stop the digestion. Adjust the cell state to be optimal for lentiviral packaging.

[0087] 1.2 Plasmid extracti...

Embodiment 3

[0121] Using the above experimental method, two kinds of CAR-T cells were successfully prepared. The inventors conducted an in vitro killing experiment on HER2-positive tumor cells, and the specific experimental results are as follows.

[0122] 1. Experimental method

[0123] 1.1 Identification of in vitro killing function of Zeta / D-CAR-T cells against HER2-positive tumor cells

[0124] 1.1.1 Dil staining

[0125] (1) HER2 + PC9 and HER2 - PC9 cells were seeded into 48-well plates, each well was seeded with 1×10 5 cells.

[0126] (2) After the cells were cultured overnight, the cell culture medium was aspirated, and the cells were washed 2 times with PBS.

[0127] (3) Add 250 μL of Dil cell membrane staining solution (concentration: 10 μM), shake gently to make the dye evenly cover all the cells.

[0128] (4) Incubate the cells at 37°C in the dark for 20 minutes.

[0129] (5) Aspirate off the cell membrane staining solution and wash 3 times with PBS.

[0130] (6) After...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a chimeric antigen receptor capable of enhancing the anti-tumor capability of a CAR-T cell, a D-CAR-T cell and application of the D-CAR-T cell, and belongs to the technical field of cell therapy. An intracellular signal region of the chimeric antigen receptor D-CAR is CD28-CD3 delta. A lentivirus is utilized to mediate D-CAR to be inserted into a T cell, the obtained D-CAR-T cell has good tumor targeting property and can accurately and specifically recognize and kill tumor cells, and the perforin level of the D-CAR-T cell is slightly higher than that of Zeta-CAR-T; and after co-incubation of D-CAR-T and tumor cells, the levels of various cytokines can be remarkably increased, and the anti-tumor capability of the CAR-T cells is further enhanced. Therefore, according to the D-CAR provided by the invention, the anti-tumor capability of the CAR-T cells is greatly enhanced by improving the expression quantity of cytokines in the CAR-T cells and the perforin level.

Description

technical field [0001] The invention belongs to the technical field of cell therapy, and specifically relates to a chimeric antigen receptor capable of enhancing the anti-tumor ability of CAR-T cells, D-CAR-T cells and applications thereof. Background technique [0002] CAR-T cell therapy has shown encouraging efficacy in the treatment of hematological malignancies, however, for solid tumors, the complex tumor microenvironment limits the efficacy of CAR-T cells, hindering the widespread use of CAR-T cell therapy . The obstacles faced by CAR-T cell immunotherapy mainly include CAR-T cell exhaustion, poor chemotaxis and infiltration to tumor sites, tumor antigen escape and heterogeneity, and complex immunosuppressive tumor microenvironment. In order to overcome these limitations and expand the use of CAR-T cells to a wider range of malignant tumors, it is necessary to design a new "super" CAR beyond the conventional structure, so that CAR-T cells have a more powerful and comp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/32C07K14/7051C07K14/70521C12N15/86C12N5/0636A61K39/0011A61P35/00C07K2319/03C07K2319/02C07K2319/33C07K2319/74C12N2510/00C12N2800/107A61K2039/5156C12N2740/15043
Inventor杨安钢阎博王鹏举王依依张仪婷贾林涛赵晶
OwnerAIR FORCE MEDICAL UNIV