System for editing CYP4F8 gene and application thereof
A CYP4F8, encoding nucleic acid technology, applied in genetic engineering, cells modified by introducing foreign genetic material, enzymes, etc., can solve problems such as reducing the viability of prostate cancer cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1. sgRNA vector construction
[0018] Using the CRISPR online design tool (http: / / crispr.mit.edu / ), according to the scoring system, the sgRNA spacer sequences were designed for exon 1, exon 2, exon 4, and exon 6 of CYP4F8, respectively. , and the corresponding oligonucleotide chains were designed according to the sgRNA spacer sequence, the sequences of which are shown in Table 2 and Table 3 below, respectively.
[0019] Table 2. Spacer sequences of sgRNAs
[0020]
[0021]
[0022] Table 3. Oligonucleotide sequences of sgRNA spacer sequences
[0023] name Oligonucleotide sequence sgRNA-1oligo1 5'-caccgAAGAACCAGTTCTGTTTCCG-3' (SEQ ID NO: 17) sgRNA-1oligo2 5'-aaacCGGAAACAGAACTGGTTCTTc-3' (SEQ ID NO: 18) sgRNA-2oligo1 5'-caccgATGACAGATCGGACGATGTC-3' (SEQ ID NO: 19) sgRNA-2oligo2 5'-aaacGACATCGTCCGATCTGTCATc-3' (SEQ ID NO: 20) sgRNA-3oligo1 5'-caccgAGGCAGGCGTCAGCAAGCGA-3' (SEQ ID NO: 21) sgRNA-3oligo2 5'-a...
Embodiment 2
[0025] Example 2. Cell transfection and detection of knockout efficiency
[0026] The LentiCRISPR V2 plasmid carrying the sgRNA sequence was transfected into 293T cells using lipofection. Specifically, 293T cells were inoculated with complete medium (high glucose DMEM medium with 10% fetal bovine serum) in advance, and cultured in a 5% CO2, 37°C constant temperature incubator for 1 day, until the cells reached 70-90% confluence when transfected. Transfection reagent (125 μl Opti-MEM, 3.75 μl Lipo3000R) and DNA premix (125 μl Opti-MEM, 5 μg LentiCRISPR V2 plasmid, 10 μl P3000 TM ) were mixed at a ratio of 1:1 and added to 293T cells after 5 min incubation at 25°C. After the cells were placed in a 37°C incubator for 48-72 hours, the complete medium containing 1 ng / ml puromycin was used for resistance screening, and the positive cells were recovered and cultured in the complete medium for 2-3 days. The cells were collected, and the gene knockout efficiency was identified by th...
Embodiment 3
[0030] Example 3. Gene Expression Verification
[0031] The RNA of the positive 293T cells screened by puromycin was extracted and reverse transcribed into cDNA, and the following primers were used to detect the expression of CYP4F8 gene in the cells. The results are shown in Table 5.
[0032] P-F: TCTTCGCAATCCATCACAAC (SEQ ID NO: 25)
[0033] P-R: ACCACCTTCATCTCTGCCA (SEQ ID NO: 26)
[0034] Table 5. CY4F8 expression levels
[0035]
[0036] It can be seen that the expression of CYP4F8 in 293T cells knocked out by sgRNA-2 is the lowest, and the knockout effect is the best.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More