SNP (Single Nucleotide Polymorphism) molecular marker closely linked with eggplant fruit color and application

Abstract

The invention discloses an SNP molecular marker closely linked with eggplant fruit color and application, and belongs to the technical field of molecular genetic breeding, and the SNP molecular marker is characterized by comprising an SNP molecular marker I and an SNP molecular marker II; the SNP molecular marker I comprises a nucleotide sequence as shown in SEQ ID NO.1, and the 51st basic group from the 5'end of the nucleotide sequence as shown in SEQ ID NO.1 is an SNP site I; the SNP molecular marker II comprises a nucleotide sequence as shown in SEQ ID NO.2, the 51st basic group of the nucleotide sequence as shown in SEQ ID NO.2 is the SNP site II from the 5'end, the SNP site I and the SNP site II are respectively positioned on the 95538422nd basic group and the 98266374th basic group of the eggplant chromosome 10, the 95538422nd basic group is C or T, the 98266374th basic group is C or T, the SEQ ID NO.1 is TACATAATTGATATTGATATTGATTACATAGGGGGGGA, and the SEQ ID NO.2 is

Description

technical field [0001] The invention relates to the technical field of molecular genetics and breeding, in particular to a SNP molecular marker closely linked with eggplant fruit color and its application. Background technique [0002] Eggplant (Solanum melongena L.) is an important Solanaceae vegetable with important economic value and health care value. my country is the No. 1 producer of eggplant, and the annual output of eggplant accounts for about 60% of the world's output. Eggplant fruit color is an important commodity trait of eggplant, and there are rich variations, and there are obvious differences in the demand for eggplant fruit in different regions of my country. The common purple-red eggplant is mainly determined by the anthocyanin in the peel, and its color is closely related to the content of anthocyanin. [0003] With the mature development of high-throughput sequencing technology, especially the development of a large number of SNP (Single Base Amplificati...

AI Technical Summary

Problems solved by technology

[0004] At present, the breeding of eggplant fruit color traits using traditional breeding methods is time-consuming and laborious. Generally, the fruit color of commercial eggplant can only be known after the eggplant blooms and bears fruit. The breeding cycle is long and requires a large amount of work during the period; In addition, the mapping of anthocyanin-regulated genes in eggplant peel, the screening of closely linked molecular markers, the development of molecular markers closely linked to anthocyanin-regulated genes in eggplant fruit, and the establishment of an early-stage assisted selection technology system are of great importance to the genetic improvement of eggplant color breeding. Significance, the existing technology has not effectively realized

Images