Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP (Single Nucleotide Polymorphism) molecular marker closely linked with eggplant fruit color and application

A technology of molecular markers and eggplant fruits, applied in the field of molecular genetic breeding, can solve the problems of large workload, time-consuming and laborious, long breeding cycle, etc., and achieve the effect of reducing the workload of breeding and shortening the time of gene positioning

Pending Publication Date: 2022-07-05
SOUTH SUBTROPICAL CROPS RES INST CHINESE ACAD OF TROPICAL AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the breeding of eggplant fruit color traits using traditional breeding methods is time-consuming and laborious. Generally, the fruit color of commercial eggplant can only be known after the eggplant blooms and bears fruit. The breeding cycle is long and requires a large amount of work during the period; In addition, the mapping of anthocyanin-regulated genes in eggplant peel, the screening of closely linked molecular markers, the development of molecular markers closely linked to anthocyanin-regulated genes in eggplant fruit, and the establishment of an early-stage assisted selection technology system are of great importance to the genetic improvement of eggplant color breeding. Significance, the existing technology has not effectively realized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP (Single Nucleotide Polymorphism) molecular marker closely linked with eggplant fruit color and application
  • SNP (Single Nucleotide Polymorphism) molecular marker closely linked with eggplant fruit color and application
  • SNP (Single Nucleotide Polymorphism) molecular marker closely linked with eggplant fruit color and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0035] Example: SNP molecular markers closely linked to eggplant fruit color , Its positioning and application steps are as follows:

[0036] 1. Construction and genetic analysis of EMS mutants

[0037] 1. Test plant material

[0038] Using EMS to mutagenize the purple-red eggplant inbred line, a stable genetic white eggplant mutant was obtained. The pericarp of the mutant was white and the total anthocyanin content was significantly reduced, such as figure 1 shown. The mutant is continuously selfed for multiple generations to obtain a homozygous inbred line, and after backcrossing the white eggplant mutant and the purple eggplant wild type, the F1 generation is generated, such as figure 2 As shown, the phenotypes were normal, all of which were red eggplants, showing recessive inheritance. figure 1Photographs of wild type (WT), mutant eggplant (L6-5) and F1 generation eggplant. F1 generation eggplants were selfed to obtain F2 generation eggplants, and F2 generation eggpl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP molecular marker closely linked with eggplant fruit color and application, and belongs to the technical field of molecular genetic breeding, and the SNP molecular marker is characterized by comprising an SNP molecular marker I and an SNP molecular marker II; the SNP molecular marker I comprises a nucleotide sequence as shown in SEQ ID NO.1, and the 51st basic group from the 5'end of the nucleotide sequence as shown in SEQ ID NO.1 is an SNP site I; the SNP molecular marker II comprises a nucleotide sequence as shown in SEQ ID NO.2, the 51st basic group of the nucleotide sequence as shown in SEQ ID NO.2 is the SNP site II from the 5'end, the SNP site I and the SNP site II are respectively positioned on the 95538422nd basic group and the 98266374th basic group of the eggplant chromosome 10, the 95538422nd basic group is C or T, the 98266374th basic group is C or T, the SEQ ID NO.1 is TACATAATTGATATTGATATTGATTACATAGGGGGGGA, and the SEQ ID NO.2 is

Description

technical field [0001] The invention relates to the technical field of molecular genetics and breeding, in particular to a SNP molecular marker closely linked with eggplant fruit color and its application. Background technique [0002] Eggplant (Solanum melongena L.) is an important Solanaceae vegetable with important economic value and health care value. my country is the No. 1 producer of eggplant, and the annual output of eggplant accounts for about 60% of the world's output. Eggplant fruit color is an important commodity trait of eggplant, and there are rich variations, and there are obvious differences in the demand for eggplant fruit in different regions of my country. The common purple-red eggplant is mainly determined by the anthocyanin in the peel, and its color is closely related to the content of anthocyanin. [0003] With the mature development of high-throughput sequencing technology, especially the development of a large number of SNP (Single Base Amplificati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2563/107
Inventor 赵秋芳肖熙鸥马智玲马海洋魏长宾
Owner SOUTH SUBTROPICAL CROPS RES INST CHINESE ACAD OF TROPICAL AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More