Method for detecting respiratory syncytial virus by using Cas13a protein and application thereof
A technology for syncytial virus and protein detection, which is applied in microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, etc., and can solve the problems of long detection period, high requirements for target gene sequences, and low sensitivity. , to achieve the effect of short detection period and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] This embodiment provides a method for detecting respiratory syncytial virus using Cas13a protein, using Cas13a protein, RPA amplification primer set designed from respiratory syncytial virus gene, crRNA, RNA reporter molecule and reverse transcriptase to detect respiratory syncytial virus virus, which includes the following steps:
[0043] S1. Obtain Cas13a protein
[0044] (1) Construction of expression vector pET-28a-Cas13a
[0045] Find the Cas13a gene sequence encoded by C. wiederii on NCBI, the GenBank sequence number is NZ_KI271421.1. The nucleotide sequence of the Cas13a gene is shown in SEQ ID No.4, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.5. The synthetic Cas13a gene fragment was cloned into the T vector, then double digested with NdeI and SacI, and the fragment was cloned into the pET-28a expression vector between the NdeI and SacI restriction sites to construct the expression vector pET-28a-Cas13a , its plasmid m...
Embodiment 2
[0063] This embodiment provides a method for detecting respiratory syncytial virus with Cas13a protein. The difference between this embodiment and Embodiment 1 is that the selected Cas13a protein is LwaCas13a protein. In step S5, the PCR amplification system includes the following groups: Minute:
[0064] component Dosage ddH 2 O
20μL 2×Taq Plus Master Mix II 25μL Primer 1 (10μM), shown in SEQ ID NO.7 2μL Primer 2 (10μM), shown in SEQ ID NO.8 2μL positive plasmid DNA 1μL
[0065] Wherein, the nucleotide sequence of primer 1 is shown in SEQ ID NO.7, specifically:
[0066] TAATACGACTCACTATAGGCAAGGTCCTGCACCTAGAAG;
[0067] The nucleotide sequence of primer 2 is shown in SEQ ID NO.8, specifically:
[0068] CTGTTGTTCTTTTGTTGGAAC.
[0069] The amplification reaction setup procedure is as follows:
[0070]
[0071]
[0072] The components of the RNA template transcription system include the following components:
[007...
Embodiment 3
[0081] This embodiment provides a method for detecting respiratory syncytial virus by Cas13a protein. The difference between this embodiment and Embodiment 2 is that in step S6, the Cas13a detection system includes the following components:
[0082]
[0083]
[0084] Wherein, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, specifically:
[0085] CAAGGTCCTGCACCTAGAAGGGGAAGTGAAC;
[0086] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.2, specifically:
[0087] CTGTTGTTCTTTTGTTGGAACTCTATCACAG.
[0088] Double-distilled water, working standard 4, working standard 3, working standard 2, and working standard 1 were used as RNA positive standards respectively, and the Cas13a detection system was prepared according to the above system, and the components were mixed uniformly. The reaction was carried out in the RPA dry powder tube respectively, and the RPA dry powder tube was placed in a room temperature isothermal amplification ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More