Supercharge Your Innovation With Domain-Expert AI Agents!

Composition, kit and method for detecting genome DNA of Vero cell

A technology of composition and kit, which is applied in the detection of Vero cell genomic DNA, the composition of detection of Vero cell genomic DNA, and the field of composition, which can solve the problem that the detection sensitivity is not high enough, the interference cannot be well eliminated, and the detection sensitivity is getting higher and higher. standards and other issues

Pending Publication Date: 2022-07-29
TIANGEN BIOTECH BEIJING
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] So far, the commonly used technology is generally to design primers and probes for a class of long tandem repeat sequences in the Vero cell genome. The designed primers and probes can have a certain detection sensitivity, but it is still not high. The highest can only Reach 1fg / μL
In addition, due to the high homology between the Vero genome and the human cell genome, the primers designed in the prior art cannot well exclude the interference from the human cell genome, and the sensitivity of the designed primers in the prior art is not high enough. Can not meet people's higher and higher standards for detection sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition, kit and method for detecting genome DNA of Vero cell
  • Composition, kit and method for detecting genome DNA of Vero cell
  • Composition, kit and method for detecting genome DNA of Vero cell

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0095] (2) Preparation of standard DNA

[0096] The Vero cell genomic DNA purchased from the China Institute of Testing and Inspection was diluted with nucleic acid standard dilution (Tiangen Biochemical Products, catalog number RT504), and the diluted concentration was shown in Table 2, wherein the non-template control (NTC) for ultrapure water.

[0097] Table 2:

[0098] Gradient number 1 2 3 4 5 6 7 8 concentration 300pg / μL 30pg / μL 3pg / μL 300fg / μL 30fg / μL 3fg / μL 0.3fg / μL 0.03fg / μL

[0099] (3) Probe method qPCR reaction system

[0100] The reaction system is shown in Table 3:

[0101] table 3:

[0102] component Volume required for a single reaction (μL) Template DNA (standard DNA or ultrapure water) 10 2×qPCR reaction reagents 15 Upstream primer (10μM) 0.75 Downstream primer (10μM) 0.75 Detection Probe (10μM) 0.6 Ultra-pure water 2.9 total capacity 30

[0103] (4) Prob...

Embodiment 1

[0113] Example 1 Primer, probe design and sensitivity test

[0114] 1.1 Obtaining the polynucleotide sequences of primers and probes for designing and detecting Vero cell genomic DNA:

[0115] (1) The sequence file GCF_015252025.1_Vero_WHO_p1.0_genomic.fna.gz and the repeat region annotation file GCF_015252025.1_Vero_WHO_p1.0_rm.out.gz were downloaded from the NCBI database to obtain the genome of the African green monkey (Chlorocebus sabaeus). The annotation files in the repeat area were obtained by using the RepeatMasker program (version: open-4.0.8), the RepBse database (20181026) and the Dfam_Consensus (20181026) database.

[0116] (2) According to the repeat annotation file information and the characteristics of different repeat sequences and their distribution characteristics in the genome, on the corresponding genome, extract the AluSz and AluY repeat sequences of the SINE / Alu family, and extract the satellite sequence ALR / Alpha type repeat sequences, and filtered to r...

Embodiment 2

[0139] Example 2 Influence of probe-locked nucleic acid modification on detection results

[0140] The primer probes used in this example are as follows:

[0141] Upstream primer: CATCTCACAGAGTTACATCTTTCC (SEQ ID NO: 2);

[0142] Downstream primer: CTTTTTCACCATAGCCCTCTA (SEQ ID NO: 3);

[0143] Detection probe: CC T TTCGCTAAGGCTGTTCTTGT (SEQ ID NO: 4), the underlined base is modified by locked nucleic acid;

[0144] Detection probe (unlocked nucleic acid modification): CCTTTCGCTAAGGCTGTTCTTGT;

[0145] Amplification product: CATCTCACAGAGTTACATCTTTCCCTTCAAGAAGCCTTTCGCTAAGGCTGTTCTTGTGGAATTGGCAAAGTGATATTTGGAAGCCCATAGAGGGCTATGGTGAAAAAG (SEQ ID NO: 5).

[0146] The qPCR system is the same as in Example Table 2:

[0147] The DNA concentration settings of the standards used in the qPCR standard curve are shown in Table 8:

[0148] Table 8:

[0149] gradient 1 2 3 4 5 6 7 concentration 300pg / μL 30pg / μL 3pg / μL 300fg / μL 30fg / μL 3fg / μL 0.3fg / μL ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a composition, a kit and a method for detecting Vero cell genome DNA (deoxyribonucleic acid), the composition comprises a primer and a probe, the primer comprises an upstream primer sequence: 5 '-CATTCACAGTTACATCTTCC-3' (SEQ ID NO: 2), a downstream primer sequence: 5 '-CTTTTCACCATAGCCCTCTA-3' (SEQ ID NO: 3), a primer sequence: 5 '-CATCTACATAGCCCTCTA-3' (SEQ ID NO: 4), and a probe sequence: 5 '- The probe comprises the following sequence: 5 '-CCTTTCGCTAAGGCTGTCTTGT-3' (SEQ ID NO.4). By utilizing the composition provided by the invention, the interference of genome DNA of CHO cells, escherichia coli cells and human cells can be eliminated, the genome DNA of the residual Vero cells in a biological product can be effectively detected, and the detection sensitivity is as high as 0.03 fg / mu L.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular, to a composition, a kit and a method for detecting Vero cell genomic DNA, and more particularly, to design a composition, a kit and a method for detecting Vero cell genomic DNA. Background technique [0002] Vero cells are a cell line isolated and cultured from the kidney epithelial cells of the African green monkey (Cercopithecus Aethiops). Like the canine kidney cell line (MDCK cells), it is a cell line frequently used in the production of biological products. Vero cell lines are often used in the following fields: preparation of virus vaccines, cell hosts for culturing viruses, cell hosts for culturing eukaryotic parasites, detection of E. coli toxins, etc. [0003] The vast majority of recombinant biological products are produced by large-scale genetically engineered host cells, and complex non-target products in cells are the main source of impurities in the final product, which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q2531/113
Inventor 张双宇刘玉方李晓晨孙克非
Owner TIANGEN BIOTECH BEIJING
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com