Cattle enteropeptidase catalyzing subunit gene and its gene engineering production process

An enterokinase catalytic subunit and genetic engineering technology, applied in the field of bioengineering, can solve the problems of complex structure, large molecular weight, unfavorable production and the like

Inactive Publication Date: 2002-01-23
NANJING UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Among thrombin, factor Xa, and enterokinase, both thrombin and factor Xa need to be activated by proteases in other blood coagulation reactions (transformed from an inactive single-chain form to an active single-chain form) before they have protease activity. Moreover, the molecular weight is large and the structure is complex, so it is not conducive to using genetic engineering methods as a tool enzyme production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cattle enteropeptidase catalyzing subunit gene and its gene engineering production process
  • Cattle enteropeptidase catalyzing subunit gene and its gene engineering production process

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0065] 1. Mix 100 mg of fresh calf duodenum with 1 ml of Trizol, grind and pulverize it, leave it at room temperature for 5 minutes, add 200 microliters of chloroform, mix and shake for 30 seconds, centrifuge at 11,000 rpm for 15 minutes, absorb To the aqueous phase, add 0.5 ml of isopropanol, leave at room temperature for 10 minutes, discard the supernatant, wash the precipitate with 1 ml of 75% ethanol, centrifuge at 7500 rpm for 5 minutes, dry the RNA in air, and dissolve it in 30 µl DEPC-treated water.

[0066] 2. Synthetic reverse transcription primer [5'taatacgactcactataggg(t) 17 3'], using the above RNA as a template to carry out reverse transcription reaction with AMV reverse transcriptase.

[0067] 3. Synthesize the following PCR primers:

[0068] Primer 1:5'cgggatccacattgttgg(t / a)gg(t / a)tctgactccgag 3';

[0069] Primer 2: 5'taatacgactcactataggg 3';

[0070] Primer 3:5' ggaattctaatgtagaaaactttgtatccactctgt 3'

[0071] Using the reverse transcription product in st...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of biological engineering technology. The cattle enteropeptidase catalyzing subunit gene encodes the cattle enteropeptidase catalyzing subunit and has the activity of discriminating serine protease of enteropeptidase and cutting specific amino acid sequence. The gene may be obtained from cattle's intestinal tissue by gene cloning technology. The cattle enteropeptidase catalyzing subunit may be prepared through gene engineering process and may be discriminated specifically as proteinase and used to cut the substrate containing enteropeptidase cutting site. One of the application is as tool proteinase for the specific breakage of recombinant fusion protein and the present invention is especially suitable for the research in gene engineering, biochemistry, molecular biology, etc.

Description

1. Technical field [0001] The invention belongs to the technical field of bioengineering. 2. Background technology [0002] Fusion expression in genetic engineering, that is, the target protein to be expressed and some fusion proteins or short peptide tags with specific biochemical properties, such as Escherichia coli thioredoxin, glutathione-S-transferase, Staphylococcus aureus protein A. Escherichia coli maltose-binding protein or hexahistidine short peptide is fused to form a protein for expression and production. With the help of the biochemical characteristics and properties of fusion proteins or short peptides, fusion expression can greatly simplify and facilitate product detection, property research, separation and purification. Therefore, in genetic engineering, from prokaryotic expression system (such as E. coli) to eukaryotic expression Systems (such as mammalian cells) often use fusion expression methods for the production of recombinant target proteins. But thi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/52
Inventor华子春袁榴娣
OwnerNANJING UNIV