3-deoxy-3-carbonyl-erycin lactone b and its engineeirng strain and application

A technology of saccharopolyspora mold and esters, applied in the field of macrolide compounds, can solve the problems of inability to overcome drug resistance, generation of drug resistance and the like

Inactive Publication Date: 2002-02-20
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The first generation of erythromycin is easily degraded by acid and produces drug resistance, so it is rarely used
The second-generation erythromycin transformed by chemical modification, such as roxithromycin, clarithromycin, azith...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 3-deoxy-3-carbonyl-erycin lactone b and its engineeirng strain and application
  • 3-deoxy-3-carbonyl-erycin lactone b and its engineeirng strain and application
  • 3-deoxy-3-carbonyl-erycin lactone b and its engineeirng strain and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Mass spectrometric identification of 3-deoxy-3-carbonyl-erythromycin lactone in fermentation broth: The fermentation broth of Saccharopolyspora M1 extracted by the above method was detected by ZabsPec mass spectrometer. Embodiment 1, construction of pWHM2201 plasmid

[0025]1. Design of PCR primers: In order to knock out the KR6 enzyme domain in the erythromycin synthesis gene, according to the literature CortesJ, Haydock SF, Roberts GA, et al. An unusually large multifunctional polypeptide in the erythromycin-producing polyketide synthase of Saccharopolyspora erythraea. 1990, 348 (6297): 176-8 sequence, a fragment is amplified on each side of it, and there is a 20bp overlap between the fragments. The primers are: Fragment 1: Forward: 5’-TACGAATTCAGATCTCATGCGGCTCCTGGAGTCCGCAGTGGACG; Reverse: 5’-CTCGAGGTCGCCGGTGGCCGGGCCCGCCGGCTCCCCAGCTCGACTCG; Fragment 2: Forward: 5’-CGAGTCGAGCTGGGAGCCGGCGGGCTCCCGGCCACCGGCGACCTCGAGATCGTCCAGCCT; Reverse: 5’-TTCAAGCT.GCCT

[0026] Using f...

Embodiment 2

[0032] Example 2, PCR Identification of Chromosomal Integration and Chromosomal Secondary Recombination

[0033] 1) According to the sequence of the tsr gene (Hopwood DA, Bibb MJ, Chater KF et al. Genetic manipulation of stretomyces: laboratory manual. The John Innes Foundation, England, 1985), design and identify primers: Forward: 5'-CCTGAATTCATGACTGAGTTGGACACCATCGCA Reverse: 5- TCTAAGCTTGGAAACGTTGAGAACTCGGTCTG. The length of the amplified DNA fragment was 774bp.

[0034] 2) According to the erythromycin synthetic gene sequence, select PCR primers on both sides of the KR6 enzyme domain as follows:

[0035] Forward: 5'-AACGTCTTCCCGGCGGCACC;

[0036] Reverse: 5'-GTCGAGGTAGGACCGGACCC.

[0037] The length of the amplified fragment without KR6 removal was 1,770bp, and the length of the amplified DNA fragment with KR6 removal was 1,239bp.

[0038] 3) Homologous recombination of pWHM2201 plasmid and chromosome: After making protoplasts from Rhodomolgus Saccharopolyspora A226, th...

Embodiment 3

[0041] Embodiment 3, the screening of Saccharopolyspora erythraea (Saccharopolyspora erythraea) M

[0042] After the integrant Saccharopolyspora erythromycetes Z1 was continuously passed for two generations on the non-resistant R3M slant, the protoplasts were prepared and coated with the non-resistant R3M plate, and 40 colonies were picked from it and each was continuously coated with the Tsr-containing R3M slant and the Tsr-free plate. R3M bevel. Eight colonies (S erythraea M1-M8) grew only on the non-resistant R3M slant. Inoculate 4 colonies (M1-M4) for liquid culture to extract total DNA to remove KR6 identification primers for PCR amplification. The PCR product is about 1.2kb (such as image 3 shown), indicating that the KR6 enzyme domain on the chromosome has been knocked out. Saccharopolyspora erythraea M1 CGMCC №0604 was obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to 3-deoxy-3-carbonyl-erycinlactone B, its engineering bacterial strain and application. The chemical structural formula of invented product is disclosed. The engineering bacteria of present invention is (Saccharopolyspora erythraea) MICGMCC No.0604. The invented compound is used in the preparation of antibiotics.

Description

technical field [0001] The invention relates to a macrocyclic lactone compound, an engineering strain for producing the compound and the application of the compound. Background technique [0002] Erythromycin and its derivatives are a class of antibiotics widely used clinically. The first-generation erythromycin is prone to acid degradation and drug resistance, and has been rarely used. The second-generation erythromycin transformed by chemical modification, such as roxithromycin, clarithromycin, azithromycin, dirithromycin, etc., can overcome the deficiency that the first-generation erythromycin is easily degraded by acid, and is being widely used clinically. However, it still cannot overcome the shortcoming of drug resistance. The third-generation erythromycin telithromycin, which is now being introduced to the market, is a typical representative of ketolide antibiotics, and it also uses chemical modification to modify the structure of erythromycin. The biggest characte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07D313/00C12N1/21C12P17/08
Inventor 张部昌马清钧赵志虎
Owner INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap