Recombinant protein molecule for inhibiting attack and transfer of cancer cell and angiogenesis

A technology of malignant tumor and angiogenesis, applied in peptide/protein components, anti-tumor drugs, recombinant DNA technology, etc., can solve problems affecting endothelial cell function, single function, etc.

Inactive Publication Date: 2004-08-18
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Currently common angiogenesis inhibitors only have a single function, such as endostatin and angiostatin affect the function of endothelial cells, metalloproteinase inhibitors inhibit the interaction between endothelial cells and extracellular matrix

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein molecule for inhibiting attack and transfer of cancer cell and angiogenesis
  • Recombinant protein molecule for inhibiting attack and transfer of cancer cell and angiogenesis
  • Recombinant protein molecule for inhibiting attack and transfer of cancer cell and angiogenesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0044] (1) PCR method to obtain V+DNA molecule

[0045] Design primers according to the 23rd N-terminal amino acid sequence of VEGI and the C-terminal amino acid sequence, and the upstream primer is: 5'-GCG GGATCC ATGTGTACAACTCACTGGGGTTTCACACTTTGCCAAATGGCTCCAGTTGTGAGACAAACT-3', containing 3 protective bases, BamHI site (underlined), start codon, 10 mutated amino acid CTTHWGLTLC corresponding codons, spacer sequence QMPP corresponding codons and amino acid coding sequence after position 23 of VEGI. The downstream primer is 5'-CGC GAATTC GATATTTGCTCTCCTCTATAG-3' is a sequence complementary to the C-terminal coding sequence of VEGI, and an EcoRI site (underlined) is introduced. Human genomic DNA was used as a template for PCR amplification. The PCR reaction conditions were: 98°C denaturation for 5 minutes, 94°C for 40 seconds, 60°C for 60 seconds, 72°C for 60 seconds, a total of 30 cycles, and 72°C for 10 minutes. After PCR amplification, a 500bp V+ band ( figure 1 ).

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides one kind o recombinant protein molecule for suppressing malignant tumor cell attack and metastasis and vascularization. The recombinant protein molecule is chimeric molecule constituted via connecting cyclic decapeptide CTTHWGFTLC for suppressing metalloprotease and vascular endothelial growth inhibitor VEGI. The present invention provides also nucleotides encoding the chimeric molecule, the method of producing the recombinant protein and the application of the recombinant protein.

Description

field of invention [0001] The invention relates to a recombinant protein molecule for inhibiting invasion, metastasis and angiogenesis of malignant tumor cells and a nucleic acid encoding the recombinant protein molecule. Background of the invention [0002] The most prominent feature of malignant tumor cells is invasion and metastasis, and the degradation of extracellular matrix is ​​the key to the invasion and metastasis of tumor cells. Extracellular matrix degradation is initiated by proteases secreted by different cell types involved in tumor cell invasion, and increased expression and activity of each known protease is associated with malignant growth and tumor invasion. Research conducted in the past 10 years has revealed that matrix metalloproteinases (MMPs) play a key role in tumor invasion, and high levels of MMPs in tumor sites are closely related to the degree of malignancy of tumors. [0003] MMP-2 (gelatinase A, 72 kDa) is expressed by a range of normal and tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/55A61P35/00C07K19/00C12N15/09C12N15/62C12N15/63
Inventor劳为德高虹
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI