Use of Dayan peptide/inflammation factor/in preparing tag diagnosing mammary cancer
A technology of inflammatory factors and breast cancer, which is applied in the field of markers for the diagnosis of breast cancer, can solve problems such as misdiagnosis, failure to identify breast cancer, and doctors' inability to obtain correct judgments
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0017] 1. Preparation of large inflammatory peptides
[0018] (1) Purification of large inflammatory peptides from natural materials
[0019] Using pig small intestine as raw material (500 kg), boil water for 10 minutes to inactivate endogenous protease. After low-temperature leaching with 0.2M dilute acetic acid for 10 hours, alginic acid (5 kg) was adsorbed, salted out with 320g / L sodium chloride, the salted out product was collected by filtration, fractional extraction with isopropanol, dextran Sephadex G-25 gel Filtration and cellulose weak anion DEAE exchange column chromatography, and finally separated and purified Dayanpeptide by reversed-phase high-performance liquid chromatography. Dayanpeptide is a white powder, easily soluble in water, with a molecular weight of 17,000 Daltons.
[0020] (2) Prepared by genetic engineering
[0021] Design a pair of primers as follows:
[0022] 5'GCGAATTCTATGAGCCAAACCAGGGATT 3'
[0023] 5'GCCTGCATTTCCCATATCTGGGTATTAG 3'
[0024]...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com