Method of breeding lipid-producing fungus

A technology for lipid-producing bacteria and strains, which is applied in biochemical equipment and methods, botanical equipment and methods, fungi, etc., and can solve problems such as breeding of difficult lipid-producing bacteria and low lipid production performance.

Inactive Publication Date: 2006-09-27
SUNTORY HLDG LTD
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0017] However, there is a problem that it is difficult to effectively and efficiently breed lipid-producing bacteria that produce PUFA using the above-mentioned transformation technology
[0018] Specifically, when the above-mentioned (a) technology of transforming filamentous bacteria by particle bombardment is used, the lipid production performance of the above-mentioned filamentous bacteria such as A. nidulans or N. crassa as the transformation object is low, so it is not suitable for industrial production. Lipids such as PUFA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] In this example, a specific example of obtaining a uracil-deficient strain, transforming it, and performing screening, which is one example of the breeding method of the present invention, will be described.

[0068] (1) Acquisition of uracil-deficient strains (acquisition process of auxotrophic strains)

[0069] In order to form spores of M.alpina, the bacteria were inoculated into Czapek-Dox medium (3% sucrose, 0.2% NaNO3 , 0.1% KH 2 PO 4 , 0.05% KCl, 0.05% MgSO 4 ·7H 2 O, 0.001% FeSO 4 ·7H 2 O, 2% agar, the pH value was adjusted to 6.0), at 28°C, cultured for about 2 weeks. It was suspended in Tween 80 aqueous solution (1drop / 100mL H 2 (0) Mycelium was removed through a glass filter (GlassFilter) (manufactured by Iwaki Glass Co., Ltd., product number: 3G1) to prepare a spore liquid. Using N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), according to the method of Jareonkitmongkol et al. 8 ~1×10 9 The spores were mutated.

[0070] Spread the mutated spores on GY...

Embodiment 2

[0112] In this example, an example in which a new strain, ie, a GLELO gene-introduced strain, was developed by the breeding method using the uracil-deficient strain constructed in Example 1 will be described.

[0113] (1) Construction of pDura5GLELO vector

[0114] Gene encoding fatty acid carbon chain elongation enzyme that converts γ-linolenic acid to double homo-γ-linolenic acid, based on J.M.Parker-Barnes et al.Proc.Natl.Acad.Sci.USA., 97(15), 8284- The ID of the sequence GB recorded on 8289, 2000 is the base sequence of AF206662, which was obtained by PCR amplification using the cDNA of M.alpina as a template. At this time, primers MAGLELO1 and MAGLELO2 shown below were used.

[0115] Primer MAGLELO1: CCATGGATGGAGTCGATTGCGCCATTCC (SEQ ID NO: 11)

[0116] Primer MAGLELO2: GGATCCTTACTGCAACTTCCTTGCCTTCTC (SEQ ID NO: 12)

[0117] The amplified GLELO gene was digested with restriction enzymes NcoI and BamHI to obtain a fragment of about 1 kb. pD4 was digested w...

Embodiment 3

[0134] In this example, a specific example of applying the breeding method according to the present invention to fungi of the genus Mortierella other than M. alpina will be described.

[0135] (1) Acquisition of uracil-deficient strains (acquisition process of auxotrophic strains)

[0136] In order to form spores of M.hygrophila and M.chlamydospora, these bacteria were planted on Czapek-Dox medium (3% sucrose, 0.2% NaNO 3 , 0.1% KH 2 PO 4 , 0.05% KCl, 0.05% MgSO 4 ·7H 2 O, 0.001% FeSO 4 ·7H 2 O, 2% agar, the pH value was adjusted to 6.0), at 28°C, cultured for about 2 weeks. Suspend it in Tween 80 solution (1drop / 100mL H 2 (0) Mycelium was removed through a glass filter (Glass Filter) (manufactured by Iwaki Glass Co., Ltd., product number: 3G1) to prepare a spore liquid. With N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), according to the method of Jareonkitmongkol et al. 8 ~10 9 The spores were mutated.

[0137] Spread the mutated spores on GY mediu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

It is intended to provide a breeding method whereby a lipid-producing fungus belonging to the genus Mortierella can be effectively and efficiently bred without resort to antibiotics. Transformation is carried out with the use of an auxotroph (for example, uracil auxotroph) of a fungus belonging to the Mortierella as a host. More specically speaking, a gene compensating for the auxotrophy, which is employed as a marker, is transferred into the host (the gene transfer step). Next, a transformant is selected by using the recovery from the auxotrophy as the marker (the selection step). The lipid-producing fungus may be M. aplina, for example.

Description

technical field [0001] The present invention relates to a method for breeding lipid-producing bacteria, in particular to a method for breeding lipid-producing bacteria of the genus Mortierella through transformation without using antibiotic selection. Background technique [0002] Conventionally, techniques for producing useful compounds through the metabolism of microorganisms (fermentation techniques in a broad sense) have been continuously developed and put to practical use. Specifically, for example, a lipid-producing bacterium having the ability to produce a large amount of lipid through metabolism. Typical examples of lipid-producing bacteria include Mortierella alpina and other fungi of the genus Mortierella. It is known that the Mortierella genus can produce polyunsaturated fatty acids (PUFA) represented by arachidonic acid, and the Mortierella genus is an industrially particularly useful fungus (for example, refer to Japanese Patent Publication 7- 34752 (announcem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/15C12N15/00C12N15/80C12P7/64
CPCC12P7/6463C12N15/80C12N15/03C12N1/205C12N15/8206
Inventor落合美佐河岛洋清水昌
OwnerSUNTORY HLDG LTD