Method of breeding lipid-producing fungus
A technology for lipid-producing bacteria and strains, which is applied in biochemical equipment and methods, botanical equipment and methods, fungi, etc., and can solve problems such as breeding of difficult lipid-producing bacteria and low lipid production performance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0067] In this example, a specific example of obtaining a uracil-deficient strain, transforming it, and performing screening, which is one example of the breeding method of the present invention, will be described.
[0068] (1) Acquisition of uracil-deficient strains (acquisition process of auxotrophic strains)
[0069] In order to form spores of M.alpina, the bacteria were inoculated into Czapek-Dox medium (3% sucrose, 0.2% NaNO3 , 0.1% KH 2 PO 4 , 0.05% KCl, 0.05% MgSO 4 ·7H 2 O, 0.001% FeSO 4 ·7H 2 O, 2% agar, the pH value was adjusted to 6.0), at 28°C, cultured for about 2 weeks. It was suspended in Tween 80 aqueous solution (1drop / 100mL H 2 (0) Mycelium was removed through a glass filter (GlassFilter) (manufactured by Iwaki Glass Co., Ltd., product number: 3G1) to prepare a spore liquid. Using N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), according to the method of Jareonkitmongkol et al. 8 ~1×10 9 The spores were mutated.
[0070] Spread the mutated spores on GY...
Embodiment 2
[0112] In this example, an example in which a new strain, ie, a GLELO gene-introduced strain, was developed by the breeding method using the uracil-deficient strain constructed in Example 1 will be described.
[0113] (1) Construction of pDura5GLELO vector
[0114] Gene encoding fatty acid carbon chain elongation enzyme that converts γ-linolenic acid to double homo-γ-linolenic acid, based on J.M.Parker-Barnes et al.Proc.Natl.Acad.Sci.USA., 97(15), 8284- The ID of the sequence GB recorded on 8289, 2000 is the base sequence of AF206662, which was obtained by PCR amplification using the cDNA of M.alpina as a template. At this time, primers MAGLELO1 and MAGLELO2 shown below were used.
[0115] Primer MAGLELO1: CCATGGATGGAGTCGATTGCGCCATTCC (SEQ ID NO: 11)
[0116] Primer MAGLELO2: GGATCCTTACTGCAACTTCCTTGCCTTCTC (SEQ ID NO: 12)
[0117] The amplified GLELO gene was digested with restriction enzymes NcoI and BamHI to obtain a fragment of about 1 kb. pD4 was digested w...
Embodiment 3
[0134] In this example, a specific example of applying the breeding method according to the present invention to fungi of the genus Mortierella other than M. alpina will be described.
[0135] (1) Acquisition of uracil-deficient strains (acquisition process of auxotrophic strains)
[0136] In order to form spores of M.hygrophila and M.chlamydospora, these bacteria were planted on Czapek-Dox medium (3% sucrose, 0.2% NaNO 3 , 0.1% KH 2 PO 4 , 0.05% KCl, 0.05% MgSO 4 ·7H 2 O, 0.001% FeSO 4 ·7H 2 O, 2% agar, the pH value was adjusted to 6.0), at 28°C, cultured for about 2 weeks. Suspend it in Tween 80 solution (1drop / 100mL H 2 (0) Mycelium was removed through a glass filter (Glass Filter) (manufactured by Iwaki Glass Co., Ltd., product number: 3G1) to prepare a spore liquid. With N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), according to the method of Jareonkitmongkol et al. 8 ~10 9 The spores were mutated.
[0137] Spread the mutated spores on GY mediu...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com