Detection and parting method of human papillomavirus and reagent box
A technology for human papillomavirus and papilloma, which is applied in the field of nucleic acid probes and kits for detection and typing of human papillomavirus, and can solve the problems of low clinical value and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0089] One-to-one coating of probes
[0090] 1. Preparation of chips for detection of HPV6, HPV11, HPV16 and HPV18:
[0091] name
sequence
SEQ ID
NO
HPV06
5'NH 2 TTTTTTTTTTTAGACGTTCGATTTCCACTAC3′
01
HPV11
5'NH 2 TTTTTTTTTTTGGGGGTAATAACAGATCATC3′
02
HPV16
5'NH 2 TTTTTTTTTTACCTCTGATGCCCAAATA3′
09
HPV18
5'NH 2 TTTTTTTTTTCAGGTATGCCTGCTTCAC3′
11
5'NH 2 TTTTTTTTTTTCCCTGACTTTTATGCCCAG-3′
53
NC
5'NH 2 TTTTTTTTTTTCGTTAGGTCGGAGCTTGATC-3′
54
[0092] 2. Select 6 microspheres No. 31, 32, 33, 34, 35, and 36 [Luminex Company] to coat the probes according to the following method:
[0093] (1) Place 6 kinds of microspheres Nos. 31, 32, 33, 34, 35, and 36 and a portion of EDC powder stored at -20°C in
[0094] Equilibrate at room temperature for 30 minutes;
[0095] (2) D...
Embodiment 2
[0193] Probe mixed coating method
[0194] 1. Preparation of chips for detecting HPV6, HPV11, HPV53, HPV54, HPV40, HPV42, HPV43, HPV44, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV59, HPV58 and HPV66:
[0195] HPV06
5'NH 2 TTTTTTTTTTTAGACGTTCGATTTCCACTAC 3′
HPV11
5'NH 2 TTTTTTTTTGGGGGTAATAACAGATCATC 3′
HPV53
5'NH 2 TTTTTTTTTTTTCCTCACCAATAACGC 3′
HPV54
5'NH 2 TTTTTTTTTGGAGTTGCAGCATAAATAGA 3′
HPV40
5'NH 2 TTTTTTTTTCAATAGGAGTCCGACCAG 3′
HPV42
5'NH 2 TTTTTTTTTTTGGCAGACATAATTTAGGTAGTA 3′
HPV43
5'NH 2 TTTTTTTTTTCTAATACCAGGTCCAAAAT 3′
HPV44
5'NH 2 TTTTTTTTTTTGCACTTTTAATAACCAGATCCT3′
HPV16
5'NH 2 TTTTTTTTTGAAAATAATTTGAACTGGCT 3′
HPV16
5'NH 2 TTTTTTTTTTACCTCTGATGCCCAAATA 3′
HPV18
5'NH 2 TTTTTTTTTCAGGTATGCCTGCTTCAC 3′
HPV31
5'NH 2 TTTTTTTTTTTCAGTAGGGACCGATTCAC 3′
HPV33
5'NH 2 TTTTTTTT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
