Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Adipocyte differentiation related protein gene and relativity with diabetes type2

A type 2 diabetes, gene technology, applied in the field of molecular biology, can solve the problems of no confirmed ADRP gene polymorphism and diabetes correlation, no reports of type 2 diabetes correlation, etc.

Inactive Publication Date: 2007-04-18
SHANGHAI INST FOR ENDOCRINE & METABOLIC DISEASES
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although some diabetes-related genes and polymorphism studies have been carried out, there is no report on the correlation between ADRP gene polymorphism and diabetes before the present invention, let alone the report on the correlation with type 2 diabetes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adipocyte differentiation related protein gene and relativity with diabetes type2
  • Adipocyte differentiation related protein gene and relativity with diabetes type2
  • Adipocyte differentiation related protein gene and relativity with diabetes type2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] 1. Method

[0057] 1. Extraction of peripheral blood DNA:

[0058] After removing plasma, add 500ul of concentrated blood to 500ul of PBS, pipette and mix well, then centrifuge at 10,000rpm for 1 minute or 8000rpm for 3 minutes to remove broken red blood cells; add 800ul of 0.025M KCl hypotonic solution, mix well, incubate at 37°C for 20 minutes, and centrifuge at 10,000 for 1 minute , discard the supernatant, repeat 2 to 3 times, remove red blood cells until the precipitate turns white, add 500ul TE, 4ul 10mg / ml proteinase K, 25ul 20% SDS, shake vigorously, incubate at 65°C for 30 minutes, add 500ul saturated phenol, 37°C Shake for 10 minutes, centrifuge at 12,000rpm for 10 minutes, take the supernatant, add 1ml chloroform, centrifuge at 12,000rpm for 10 minutes, take the supernatant, add 1 / 10 volume of 3M sodium acetate and 2 volumes of absolute ethanol, mix and store at -20 Precipitate overnight at ℃; centrifuge at 12,000rpm for 10 minutes, remove the supernatant, c...

Embodiment 2

[0118] Type 2 Diabetes Susceptibility Detection Kit

[0119] A kit is prepared which contains:

[0120] Name Sequence (5’→3’) Number Concentration

[0121] Forward primer CCTCAACTGGCTGGTAGGTCC SEQ ID NO: 2 dry powder 20D

[0122] Reverse primer TCACACCAGAGCAGACACCAGT SEQ ID NO: 3 dry powder 20D

[0123] PCR reaction solution containing Taq enzyme dNTP magnesium ion PCR reaction buffer

[0124] Take 3ml of blood from the subject to be tested, and use a conventional method (or use a specific kit) to extract DNA from the blood. Dilute the PCR primers in the type 2 diabetes detection kit to 1 μmol / μl, and use the extracted DNA as a template to perform a PCR reaction with the provided primers. After purification of PCR products, ABI-PRISM TM The 377 DNA sequencer performs bidirectional sequencing by the fluorescent labeling end termination method, and the sequence interpretation and SNP confirmation are performed with Polyphred software.

[0125] As a result, among the test ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method to test susceptibility of 2-type diabetes. Compared with normal, variability of protein gene ADRP, transcript and / or protein about adipose cells differentiation of individuals are tested. It is indicated that the individual has more probability to suffer 2-type diabetes than others if there is variability. The invention also discloses the reagent boxes.

Description

technical field [0001] The present invention relates to the field of molecular biology. More specifically, it relates to the single nucleotide polymorphism (singlenucleotide polymorphism, SNP) of human adipocyte differentiation-related protein gene (Adipose Differentiation-Related Protein, ADRP) and its correlation with type 2 diabetes. The present invention also relates to methods and kits for detecting these SNPs. Background technique [0002] Diabetes mellitus is a group of syndromes composed of different pathophysiological changes characterized by abnormal glucose metabolism. There is great heterogeneity among different patients. The two main pathophysiological changes are insufficient insulin secretion and insulin resistance. [0003] Type 2 diabetes is a complex polygenic genetic disease (O'Rahilly S, Wainscoat JS, Turner RC. Type 2 (non-insulin-dependent) diabetes mellitus Newgenetics for old nightmares. Diabetologia, 1988, 31: 407-14; Yukio Horikawa, Naohisa Oda, N...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 罗敏
Owner SHANGHAI INST FOR ENDOCRINE & METABOLIC DISEASES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com