Adipocyte differentiation related protein gene and relativity with diabetes type2
A type 2 diabetes, gene technology, applied in the field of molecular biology, can solve the problems of no confirmed ADRP gene polymorphism and diabetes correlation, no reports of type 2 diabetes correlation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] 1. Method
[0057] 1. Extraction of peripheral blood DNA:
[0058] After removing plasma, add 500ul of concentrated blood to 500ul of PBS, pipette and mix well, then centrifuge at 10,000rpm for 1 minute or 8000rpm for 3 minutes to remove broken red blood cells; add 800ul of 0.025M KCl hypotonic solution, mix well, incubate at 37°C for 20 minutes, and centrifuge at 10,000 for 1 minute , discard the supernatant, repeat 2 to 3 times, remove red blood cells until the precipitate turns white, add 500ul TE, 4ul 10mg / ml proteinase K, 25ul 20% SDS, shake vigorously, incubate at 65°C for 30 minutes, add 500ul saturated phenol, 37°C Shake for 10 minutes, centrifuge at 12,000rpm for 10 minutes, take the supernatant, add 1ml chloroform, centrifuge at 12,000rpm for 10 minutes, take the supernatant, add 1 / 10 volume of 3M sodium acetate and 2 volumes of absolute ethanol, mix and store at -20 Precipitate overnight at ℃; centrifuge at 12,000rpm for 10 minutes, remove the supernatant, c...
Embodiment 2
[0118] Type 2 Diabetes Susceptibility Detection Kit
[0119] A kit is prepared which contains:
[0120] Name Sequence (5’→3’) Number Concentration
[0121] Forward primer CCTCAACTGGCTGGTAGGTCC SEQ ID NO: 2 dry powder 20D
[0122] Reverse primer TCACACCAGAGCAGACACCAGT SEQ ID NO: 3 dry powder 20D
[0123] PCR reaction solution containing Taq enzyme dNTP magnesium ion PCR reaction buffer
[0124] Take 3ml of blood from the subject to be tested, and use a conventional method (or use a specific kit) to extract DNA from the blood. Dilute the PCR primers in the type 2 diabetes detection kit to 1 μmol / μl, and use the extracted DNA as a template to perform a PCR reaction with the provided primers. After purification of PCR products, ABI-PRISM TM The 377 DNA sequencer performs bidirectional sequencing by the fluorescent labeling end termination method, and the sequence interpretation and SNP confirmation are performed with Polyphred software.
[0125] As a result, among the test ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com