Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fusion polypeptide suitable as a cytotoxin

a cytotoxin and polypeptide technology, applied in the field of fusion polypeptides, can solve the problems of low detection efficiency, lack of proficient targeting, and high dose requirements, and achieve the effects of improving detection efficiency, reducing the risk of cancer, and improving the survival ra

Inactive Publication Date: 2006-04-13
DEUTES KREBSFORSCHUNGSZENT STIFTUNG DES OFFENTLICHEN RECHTS
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0006] Thus, the technical problem underlying the present invention is to provide parvovirus based means for gene therapy, in particular for targ

Problems solved by technology

Besides selectivity, a main problem of such compounds consists in the side effects but also in the lack of proficient targeting of the substance, which leads to the requirement for relatively high doses.
However, so far, little is known about the nature of the oncosuppressive potential of parvoviruses (which is independent of the parvoviral replicon) and, accordingly, the therapeutic use of said viruses, e.g., incorporated in heterologous systems such as recombinant adenoviruses or Measles viruses, for targeted gene therapy, e.g. cancer therapy is still in its infancy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion polypeptide suitable as a cytotoxin
  • Fusion polypeptide suitable as a cytotoxin
  • Fusion polypeptide suitable as a cytotoxin

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0043] Generation of Fusion Polypeptide Constructs for Testing Putative Oncotoxins for their Effects on Mammalian Cells

[0044] Given the supposition that NS1 works as a scaffold protein, connecting the catalytic subunit of casein kinase II (CKIIα) to tropomyosin, artificial peptides were designed harboring the tropomyosin binding region of MVM NS1 and connecting either CKIIα (or variants thereof) or just a known CKIIα binding site (FIG. 1). PCR-derived fragments composed of a tropomyosin binding site (TMB) derived from the parvovirus MVMp NS1 protein (amino acids 235 to 279), the stabilizer polypeptide EGFP derived from pEGFP (Becton Dickinson, Heidelberg), and either a casein kinase IIα binding site (derived from CKIIβ: DLEPDEELED) or the functional casein kinase 11 catalytic subunit CKIIα (NCB1 L15618) isolated from the mouse fibroblast cell line A9. (CKIIB) were cloned directly into pCR3.1 (Invitrogen, Karlsruhe), due to 3′adenosinetriphosphate overhangs generated by Taq-polymera...

example 2

[0046] Toxicity Assays

[0047] Colony formation inhibition assays were performed with the constructs described in Example 1. A9 or HEK293 (2×105 cells per 25 cm2) were transfected with 10 μg plasmid DNA using 25 μl lipofectamin in DMEM without serum according to the manufacturer's conditions (Invitrogen). After 5 hr incubation transfection medium was replaced with DMEM containing 10% FBS and cells were grown for additional 48 h in absence of G418 before subdividing into 150 cm2 plates where transfected cells were selected for by addition of 400 μg / ml G418 (SIGMA, Taufkirchen). Growing colonies were fixed and stained according to McCoy after two to three weeks growth under selective pressure. Two representative experiments are shown in FIG. 2a and FIG. 2b. While expression of the two effector proteins (TMB=CKIIα (FIG. 2a) and TMB=CKIIB (FIG. 2b) allowed only few colonies to be generated in A9 cells in comparison to the control peptides, almost similar transfectants were generated in a...

example 3

[0049] Generation of Semi-Synthetic Toxins by Chimeric PCR

[0050] Fusion constructs are generated by consecutive PCR reactions using overlapping primer pairs. In a first reaction the individual PCR-elements generated: TMB(GFP): Lefthand primer A 5′-GATATCCCATGGGGAAAACTAACTTTTTAAAAGAAGGCGA-3′ (SEQ ID NO: 3) with righthand primer B: 5′-TCCTCGCCCTTGCTCACCATATGGCAACTTAACATAGGT-3′ (SEQ ID NO: 4) using pdBMVp (Kestler et al, 1999) as a template. (TMB)-GFP.CKIIB: C: 5′-ACTATGTTAAAGTTTGCCATATGGTGAGCAAGGGCGAGGA-3′ (SEQ ID NO: 5) with D: 5′-GCGGCCGCTCTAGATTAATCTTCCAATTCTTCATCGGGTTCCAAATCCCTCC GATGCTTGTACAGCTCGTCCATGCCGAG-3′ (SEQ ID NO: 6) using pEGFP (Becton Dickinson) as a template. GFP-(CKIIα): E: 5′-CCCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGG-3′ (SEQ ID NO: 7) and F: 5′-TCCTCGCCCTTGCTCACCATCTGCTGAGCGCCAGCGGCAGG-3′ (SEQ ID NO: 8) using pEGFP as a template. (TMB)-GFP-(CKIIα): Primer A and F using pEGFP as a template (GFP)-CKIIα(wt or E81A): G: 5′-CTGCCGCTGGCGCTCAGCAGATGGTGAGCAAGGGCGAGGA-3′ (SEQ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Therapeuticaaaaaaaaaa
Nucleic acid sequenceaaaaaaaaaa
Fluorescenceaaaaaaaaaa
Login to View More

Abstract

The present invention relates to fusion polypeptides including (a) a binding site for a cytoskeleton component and (b1) an effector protein or the catalytic domain thereof or (b2) a binding site for the effector protein, and nucleic acid sequences encoding the fusion polypeptides. Moreover, various therapeutic uses of the fusion polypeptides are described, e.g., the treatment of diseases associated with the presence of an aberrant cell population, preferably cancer or AIDS.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application is a Continuation in Part application of and claims priority to PCT International Application No: PCT / EP2004 / 004477 filed on Apr. 28, 2004, which in turn claims priority to European Patent Application No. 03009952.7 filed on Apr. 30, 2003, the contents of which are incorporatated herein for reference for all purposes.BACKGROUND OF THE INVENTION [0002] 1. Field of Technology [0003] The present invention relates to fusion polypeptides comprising (a) a binding site for a cytoskeleton component and (b1) an effector protein or the catalytic domain thereof or (b2) a binding site for said effector protein, and nucleic acid sequences encoding said fusion polypeptides. Furthermore, the present invention relates to various therapeutic uses of said fusion polypeptides, e.g., the treatment of diseases associated with the presence of an aberrant cell population, preferably cancer or AIDS. [0004] 2. Discussion of Related Art [0005] F...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C07H21/04C12P21/04C07K14/015
CPCC07K14/005C12N2750/14322C12N9/1205C07K2319/00A61P31/12A61P35/04
Inventor NUESCH, JURGROMMELAERE, JEAN
Owner DEUTES KREBSFORSCHUNGSZENT STIFTUNG DES OFFENTLICHEN RECHTS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com