Identification of a new class of epsp synthases

a synthase and epsp technology, applied in the field of plant molecular biology, can solve the problems of toxic to bacterial cells, toxic to plant cells, toxic to these bacteria,

Inactive Publication Date: 2010-06-10
ATHENIX
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The Class III EPSP synthase enzymes provide enhanced tolerance to glyphosate, enabling the selective killing of sensitive weeds while protecting transformed organisms, and facilitate the identification of additional glyphosate-resistant proteins through sequence analysis.

Problems solved by technology

Since glyphosate-class herbicides inhibit aromatic amino acid biosynthesis, they not only kill plant cells, but are also toxic to bacterial cells.
Glyphosate inhibits many bacterial EPSP synthases, and thus is toxic to these bacteria.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification of a new class of epsp synthases
  • Identification of a new class of epsp synthases
  • Identification of a new class of epsp synthases

Examples

Experimental program
Comparison scheme
Effect test

example 1

Isolation of EPSPS Genes

[0150]Genes coding for class III EPSPS enzymes have been isolated from seven different bacteria (Klebsiella pneumoniae, Agrobacterium radiobacter, Rhizobium sp., Brevundomonas vesicularis, Agrobacterium tumefaciens, Pseudomonas syringae, and Brucella / Ochrobactrum).

[0151]The DNA coding sequence and the amino acid sequence of the grg8 open reading frame are provided in U.S. Patent Application No. 60 / 640,195, filed Dec. 29, 2004, and provided in SEQ ID NO:7 and SEQ ID NO:8 of this application, respectively.

[0152]The DNA coding sequence and amino acid sequence of the grg12 open reading frame are provided in SEQ ID NOS:57 and 10 and SEQ ID NOS:58 and 59 of this application, respectively.

[0153]The DNA coding sequence and amino acid sequence of the grg 15 open reading frame are provided in SEQ ID NO:11 and SEQ ID NO:12 of this application, respectively.

[0154]The DNA coding sequence and amino acid sequence of the grg6 open reading frame are provided in GenBank Access...

example 2

Cloning the EPSP Synthase Gene from Pseudomonas syringae pv Tomato Strain DC3000

[0161]The EPSP synthase coding sequence was PCR-amplified from genomic DNA of Pseudomonas syringae pv. tomato strain DC3000 (ATCC BAA-871) using the following primers: CAGAGATCTGGCATGCGACCTCAAGCCACTCTC (upper, SEQ ID NO:61) and CAGGGCGCGCCTCAGCGCTGAACACTCACCC (lower, SEQ ID

[0162]NO:62). The resultant 1.3 kb PCR product was digested with Bgl II and Asc I, ligated into modified pUC18 which had been digested with BamH I and Asc I, then electroporated into DH5α cells. Plasmid DNA was prepared from ampicillin resistant colonies and analyzed by restriction digest. One clone was chosen for further analysis. The DNA sequence of the insert was determined using techniques well known in the art and found to be 100% identical to the published sequence for strain DC3000 (Genbank accession number AE016853 bases 1,140,091 through 1,141,347). This plasmid was named pAX703, and the EPSPS ORF was named grg6.

[0163]Plasmid ...

example 3

Cloning the EPSP Synthase Gene from Agrobacterium radiobacter Strain C58

[0164]The EPSP synthase coding sequence was PCR-amplified from genomic DNA of Agrobacterium tumefaciens strain C58 (ATCC 33970) using the following primers: CAGGGATCCGGCATGATCGAACTGACCATCACCC (upper, SEQ ID NO:63) and CAGGGCGCGCCTCAGTGCTGCGGCTCGGCAGCG (lower, SEQ ID NO:64). The resultant 1.3 kb PCR product was digested with BamH I and Asc I, ligated into modified pUC18 which had been digested with BamH I and Asc I, then electroporated into DH5α cells. Plasmid DNA was prepared from ampicillin resistant colonies and analyzed by restriction digest. One clone was chosen for further analysis. The DNA sequence of the insert was determined using techniques well known in the art and found to be 100% identical to the published sequence for strain C58 (Genbank accession number NC—003304 bases 628398 through 629675). This plasmid was named pAX702, and the C58 EPSPS ORF was named grg9.

[0165]Plasmid pAX702 was transformed in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
pHaaaaaaaaaa
Login to View More

Abstract

Compositions and methods for conferring tolerance to glyphosate in bacteria, plants, plant cells, tissues and seeds are provided. Compositions include a novel class of EPSPS enzymes, designated Class III, and polynucleotides encoding such enzymes, vectors comprising those polynucleotides, and host cells comprising the vectors. The novel proteins comprise at least one sequence domain selected from the Class III domains provided herein. These sequence domains can be used to identify EPSP synthases with glyphosate resistance activity.

Description

CROSS REFERENCE TO RELATED APPLICATION[0001]This application is a divisional application of U.S. application Ser. No. 11 / 400,598, filed Apr. 7, 2006 which claims the benefit of U.S. Provisional Application Ser. Nos. 60 / 669,686, filed Apr. 8, 2005; 60 / 678,348 filed May 6, 2005; 60 / 695,193 filed Jun. 29, 2005; and 60 / 725,182 filed Oct. 11, 2005, the contents of which are hereby incorporated in their entirety by reference herein.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY[0002]The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named “384669_SequenceListing.txt”, created on Feb. 15, 2010, and having a size of 132 kilobytes and is filed concurrently with the specification. The sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.FIELD OF THE INVENTION[0003]This invention relates to plant molecular biology,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A01N57/18C12N15/52C12N5/04A01H5/00A01H5/10A01H1/00A01P13/00
CPCC12N15/8275C12N9/1092
InventorCAROZZI, NADINECARR, BRIANHAMMER, PHILIP E.
OwnerATHENIX