Ligation-based detection of genetic variants

a genetic variant and ligation technology, applied in the field of multi-plexed selection, amplification, and detection of targeted regions, can solve the problem of invasive procedures carrying a risk of miscarriage of around 1% mujezinovi

Inactive Publication Date: 2012-02-09
TANDEM DIAGNOSTICS
View PDF13 Cites 217 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0017]It is an advantage that using degenerate bridging oligonucleotides obviates the need to predetermine the maternal and fetal polymorphic content for a selected nucleic acid region prior to employing the detection methods of the assay system.

Problems solved by technology

However, these invasive procedures carry a risk of miscarriage of around 1% Mujezinovic and Alfirevic, Obstet Gynecol 2007; 110:687-694.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ligation-based detection of genetic variants
  • Ligation-based detection of genetic variants
  • Ligation-based detection of genetic variants

Examples

Experimental program
Comparison scheme
Effect test

example 1

General Aspects of the Assay Systems of the Invention

[0175]A number of assay formats were tested to demonstrate the ability to perform selective amplification and detection of independent loci to demonstrate multiplexed, ligation-based detection of a large number (e.g., 96 or more) of nucleic acid regions of interest.

[0176]These assays were designed based on human genomic sequences, and each interrogation consisted of two fixed sequence oligos per selected nucleic acid region interrogated in the assay. The first oligo, complementary to the 3′ region of a genomic region, comprised the following sequential (5′ to 3′) oligo elements: a universal PCR priming sequence common to all assays: TACACCGGCGTTATGCGTCGAGAC (SEQ ID NO:1); a nine nucleotide degenerate identification code where each specific sequence is intended to be specific to a single oligonucleotide molecule and its progeny; a 9 base locus- or locus / allele-specific sequence that acts as a locus code in SNP-independent assay for...

example 2

Preparation of DNA for Use in Tandem Ligation Procedures

[0180]Genomic DNA from a Caucasian male (NA12801) or a Caucasian female (NA11995) was obtained from Coriell Cell Repositories (Camden, N.J.) and fragmented by acoustic shearing (Covaris, Woburn, Mass.) to a mean fragment size of approximately 200 bp.

[0181]The Coriell DNA was biotinylated using standard procedures. Briefly, the Covaris fragmented DNA was end-repaired by mixing the following components in a 1.5 ml microtube: 5 μg DNA, 12 μl 10× T4 ligase buffer, 50 U T4 polynucleotide kinase, and H20 to 120 μl. This reaction was incubated at 37° C. for 30 minutes. The end-repaired DNA was diluted using 10 mM Tris 1 mM EDTA pH 8.5 to a concentration of ˜2 ng / μl.

[0182]5 μl DNA was placed in each well of a 96-well plate. The plate was incubated at 95° C. for 3 minutes, cooled to 25° C., and spun again for 10 seconds at 250×g. 15 uL of biotinylation master mix [1× TdT buffer, 8U TdT, 250 μM CoCl2, 0.01 nmol / μl biotin-16-dUTP (Roche, ...

example 3

Exemplary Assay Formats Using Tandem Ligation

[0184]Numerous tandem ligation assay formats using the biotinylated DNA were tested to illustrate proof of concept for the assay systems of the invention, and demonstrated the ability to perform highly multiplexed, targeted detection of a large number of independent loci using the series of different assay formats. The exemplary assay systems of the invention were designed to comprise 96 or more interrogations per loci in a genetic sample, and in cases where SNPs were detected the assay formats utilized 192 or more separate interrogations, each utilizing the detection of different alleles per 96 loci in genetic samples. The examples described for each assay format utilized two different sets of fixed sequence oligonucleotides and / or bridging oligos (as described in Example 1), comprising a total 96 or 192 interrogation reactions for the selected nucleic acid regions depending upon whether or not SNPs were identified.

[0185]A first exemplar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting temperaturesaaaaaaaaaa
concentrationaaaaaaaaaa
v/vaaaaaaaaaa
Login to View More

Abstract

The present invention provides assays systems and methods for detection of genetic variants in a sample, including copy number variation and single nucleotide polymorphisms. The invention preferably employs the technique of tandem ligation, i.e. the ligation of two or more fixed sequence oligonucleotides and one or more bridging oligonucleotides complementary to a region between the fixed sequence oligonucleotides.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]The present application claims priority to U.S. Ser. No. 61 / 371,605, filed Aug. 6, 2010, which is herein incorporated by reference in its entirety.FIELD OF THE INVENTION[0002]This invention relates to multiplexed selection, amplification, and detection of targeted regions from a genetic sample.BACKGROUND OF THE INVENTION[0003]In the following discussion certain articles and methods will be described for background and introductory purposes. Nothing contained herein is to be construed as an “admission” of prior art. Applicant expressly reserves the right to demonstrate, where appropriate, that the articles and methods referenced herein do not constitute prior art under the applicable statutory provisions.[0004]Genetic abnormalities account for a wide number of pathologies, including pathologies caused by chromosomal aneuploidy (e.g., Down's syndrome), germline mutations in specific genes (e.g., sickle cell anemia), and pathologies caused b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68
CPCC12Q1/6827C12Q1/6862C12Q1/6809C12Q2525/155C12Q2525/161C12Q2533/107C12Q2535/131C12Q2565/514C12Q2565/543
InventorOLIPHANT, ARNOLDSPARKS, ANDREWSTUELPNAGEL, JOHNSONG, KEN
OwnerTANDEM DIAGNOSTICS