Identification of small molecules that facilitate therapeutic exon skipping

a small molecule and exon skipping technology, applied in the field of identification of small molecules that facilitate the therapeutic exon skipping, can solve the problems of substantial side effects, progressive muscle function loss, and substantial impact on the practicality of chronic administration of expensive to produce oligonucleotides

Inactive Publication Date: 2014-03-20
RGT UNIV OF CALIFORNIA
View PDF0 Cites 61 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent is about a new therapy for Duchenne Muscular Dystrophy (DMD) called exon skipping. The therapy uses antisense oligonucleotides (AO) to target specific parts of the dystrophin gene and restore the reading frame. The patent aims to improve the effectiveness of the therapy by increasing the amount of dystrophin produced and making it more effective in multiple muscle groups. The patent also discusses the use of synergistic treatments that can improve the efficacy of the therapy while reducing the dosage and toxicity of the AO. Overall, the patent aims to improve the practicality of exon skipping therapy for DMD.

Problems solved by technology

Both of these activities are required for muscle cell health, and thus the absence of dystrophin leads to progressive loss of muscle function.
There are no curative therapies for DMD, and the only demonstrated pharmacological treatment is corticosteroids, which may prolong ambulation for up to 3 years, but with substantial side effects [6].
For example, synergistic treatments that would permit equal efficacy with reduced AO dose, accompanied by lower toxicity, could substantially impact the practicality of the chronic administration of expensive to produce oligonucleotides [17].

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification of small molecules that facilitate therapeutic exon skipping
  • Identification of small molecules that facilitate therapeutic exon skipping
  • Identification of small molecules that facilitate therapeutic exon skipping

Examples

Experimental program
Comparison scheme
Effect test

example i

Identification of Small Molecule Enhancers of Antisense Mediated Exon Skipping

[0089]In this Example, we describe the implementation of a strategy to identify compounds that synergize with AO to promote exon skipping and the follow-up of a lead hit, dantrolene, in mutation repair of specific mouse and human models of Duchenne muscular dystrophy in vitro and in vivo. In contrast to prior screens aimed at identifying small molecules which impact exon skipping, our screen is unique at least because it relies on robust quantitation of a skipping reporter in the context of a muscle lineage cell in the presence and absence of suboptimal AO. These screens were performed using a mouse muscle cell line (C2C12) expressing a human DMD exon 50 GFP based reporter [18] selected to minimize experimental variation and sensitivity in the context of an automated and quantitative fluorescent scanning system.

[0090]The BioMol small molecule library (n=503) was screened at an effective concentration of 10...

example ii

Supplementary Studies

A. Materials and Methods

High-Throughput Screen and Secondary Screening in the Reporter Cell Line

[0103]A stable clone was generated from C2C12 cells transfected with a human exon 50 DMD GFP reporter (ex50GFP) that has been previously described [18]. Ex50GFP reporter myoblasts were seeded into uncoated 384 well plates and were incubated for 4 hours either with or without 300 nM of 2′-O-methyl phosphorothioate AON6 [5′ AACUUCCUCUUUAACAGAAAAGCAUAC 3′ (SEQ ID NO:1)] targeting the human exon 50 splice donor site. Cells were transfected with AON6 using the FUGENE (Roche) transfection reagent per manufacturer's instructions. Following AON6 incubation, each component of the BioMol library (n=503) was screened at 10 uM concentration with a final concentration of the DMSO carrier being 1%. Forty-eight hours later fluorescence was measured using the MicroXpress high content imager and analyzed using MetaXpress. Immediately preceding imaging, DNA was stained with Hoescht for...

example iii

Further Data

[0112]The experiments described in the figures as summarized below were carried out using methods described elsewhere herein, and / or by conventional methods that are well-known by those of skill in the art.

[0113]These experiments provide data showing, e.g., that 7 additional small molecule compounds can enhance exon skipping of the DMD gene of human myotube which are exon 51 skippable. See FIGS. 16, 17 and 18. It is noted that two of these molecules (Ryanodine and S107 (called a RYCAL) target the ryanodine receptor, which is also targeted by dantrolene. See FIGS. 19 and 20. Without wishing to be bound by any particular mechanism, it is suggested that this observation supports the conclusion that blocking the ryanodine receptor is one of the mechanisms of this effect.

[0114]Furthermore, additional confirmatory tests (titrations) are presented and functional testing of dantrolene is shown in a mouse system. FIG. 21 shows that low dose AO (exon 23 in mouse that repairs the m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates, e.g., to a method for enhancing exon skipping in a pre-mRNA of interest, comprising contacting the pre-mRNA with an effective amount of a small molecule selected from the compounds shown in Table 1, or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof, and, optionally, with an antisense oligonucleotide that is specific for a splicing sequence in the pre-mRNA Methods for treating Duchenne muscular dystrophy (DMD) are disclosed.

Description

[0001]This application claims the benefit of the filing date of U.S. Provisional Application No. 61 / 700,661, filed Sep. 13, 2012, and is a CIP of PCT Application No. PCT / US2012 / 053157 filed Aug. 30, 2012, which claims the benefit of the filing date of U.S. Provisional Application No. 61 / 529,041, filed Aug. 30, 2011, all of which are incorporated by reference herein in their entireties.[0002]This invention was made with Government support of Grant No. W81XWH-05-1-0616, awarded by the Department of Defense, and 5RC1AR058333, awarded by the National Institutes of Health. The Government has certain rights in this invention.SEQUENCE LISTINGSequence Listing[0003]The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 13, 2013, is named 58086-354490_SL.txt and is 37,016 bytes in size.BACKGROUND INFORMATION[0004]Duchenne muscular dystrophy (DMD) is a let...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/4178C12Q1/68A61K31/7105
CPCA61K31/4178C12Q1/6897A61K31/7105A61K31/122A61K31/138A61K31/166A61K31/277A61K31/4025A61K31/404A61K31/407A61K31/4184A61K31/454A61K31/475A61K31/5377A61K31/5415A61K31/549A61K31/554A61K31/609A61K31/7064A61K31/7088A61K31/713A61K45/06C12N15/113C12N2310/113C12N2310/3233C12N2320/31C12N2320/33C12Q1/6806A61K2300/00
InventorNELSON, STANLEY F.MICELI, CARRIEMORAN, MIRIANA
OwnerRGT UNIV OF CALIFORNIA