Treating diabetes with genetically modified beta cells

Inactive Publication Date: 2019-04-04
SDF BIOPHARMA INC
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent describes a method of treating diabetes by giving transgenic beta cells to patients that produce a specific protein called a fugetactic agent. These cells are designed to protect against damage from immune cells and can be either autologous or allogeneic. The ideas behind this treatment involve reducing inflammation and improving the survival of the beta cells. The patent also mentions modifying the protein to improve its half-life or activity. Overall, this patent provides a way to potentially improve the treatment of diabetes using beta cells.

Problems solved by technology

In subjects with type 1 diabetes (T1D), beta cells are attacked and destroyed by the immune system and, as a result, subjects with T1D cannot efficiently produce their own insulin.
Type 2 diabetes (T2D) occurs when a subject's persistently high blood sugar overwhelms the capacity of a subject's beta-cells to produce enough insulin to prevent hyperglycemia in the subject and leads to beta-cell malfunction, de-differentiation, and death.
However, infiltration of mononuclear immune cells (T-cells, B-cells, and NK cells) results in the failure of the beta cell transplantation.
However, half of the beta cells die shortly after transplantation, and this is thought to be due to low oxygen tension, an active immune response, and high levels of toxins and drugs in the liver.
Therefore, several alternative sites for transplantation have been tested including the intestine, kidney capsule, omentum, and subcutaneous, which may be best for patient safety, but have not been fully evaluated for systemic release of insulin.
This means that repeated surgeries are required to replace the micro-encapsulation devices when the device is no longer functional.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Treating diabetes with genetically modified beta cells
  • Treating diabetes with genetically modified beta cells
  • Treating diabetes with genetically modified beta cells

Examples

Experimental program
Comparison scheme
Effect test

example 1

ls Used to Assess Expression Levels of CXCL12-a and -b Isoforms

[0119]HEK293 Cells were Transfected with 2 Different Isoforms of CXCL12 (Alpha and Beta) using commercially available plasmids for each isoform (plasmids available from GenScript). Transfected cells were selected with 250 ug / mL of G418 (commercially available from ThermoFisher) and a stable pool for each isoform was created. Cells were allowed to condition a suitable medium for 3 days. Conditioned medium from the transfected HEK293 cells expressing CXCL12 alpha and CXCL12 beta were diluted 1:1 with assay dilution buffer. Two separate pools were established for each isoform and then the concentration of each isoform in solution were obtained by absorption using a standardized concentration curve.

[0120]This experiment was repeated twice and the results are as follows:

CXCL12 alphaCXCL12 beta1.310 nM1410 nM2.274 nM1330 nM

[0121]The above results evidence that transgenic model cells express CXCL12 beta at significantly higher ...

example 2

ls Used to Assess Expression Levels of Other Isoforms of CXCL12

[0122]HEK293 cells were transfected with 5 different isoforms of CXCL12 (alpha and beta) using commercially available plasmids for each isoform (plasmids available from GenScript). Transfected cells were selected with 250 ug / mL of G418 (commercially available from ThermoFisher) and a stable pool for each isoform was created. Cells were allowed to condition in a suitable medium for 3 days. The conditioned medium was separated in a 4-8% NuPage gel (commercially available from ThermoFisher) with MES buffer and transferred to nitrocellulose (iBLOT).

[0123]Expression levels were detected with HRP labeled, anti-FLAG tag antibody / TMB chromogen (available from GenScript) on a Western Blot, as shown in FIG. 1. The results evidenced that the gamma, delta and theta isoforms of CXCL12 had greater concentrations than the alpha or beta isoforms.

example 3

on of Transgenic Beta Cells

[0124]Pancreatic beta cells derived from human induced pluripotent stem cells were purchased from Takara Bio USA, Inc. (Mountain View, Calif.) and cultured according to provided instructions.

[0125]Cells were transduced with lentiviral vectors (pLenti-C-Myc-DDK, OriGene Technologies, Rockville, Md.) containing a human CXCL12 isotype (CXCL12a / SDF-lalpha or CXCL12b / SDF-lbeta) or control. The lentiviral vectors were used at a ratio of about 10:1 per beta cell. The sequences, including the tag (underlined) are provided below. Concentration of the CXCL12 isotype was determined by ELISA (RayBioTech, Norcross, Ga.) (Table 1).

CXCL12a (aka SDF1a)Accession No. NM_199168SEQ ID NO.: 9ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGACGCGTACGCGGCCGCTCGAGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Described herein are human transgenic beta cells expressing fugetactic levels of CXCL12 to a subject in need thereof. Also described herein are beta cells comprising a transgene comprising a nucleic acid sequence encoding CXCL12.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority to U.S. Provisional Application Nos. 62 / 567,604, filed Oct. 3, 2017; 62 / 568,117, filed Oct. 4, 2017; 62 / 637,913, filed Mar. 2, 2018; 62 / 662,651, filed Apr. 25, 2018; 62 / 694,634, filed Jul. 6, 2018; 62 / 696,603, filed Jul. 11, 2018; 62 / 717,587, filed Aug. 10, 2018; 62 / 719,975, filed Aug. 20, 2018; and 62 / 734,910, filed Sep. 21, 2018; each of which is incorporated by reference herein in its entirety.SEQUENCE LISTING[0002]The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 25, 2018, is named 054610-501001US SL.txt and is 8,646 bytes in size.FIELD OF THE INVENTION[0003]The invention is directed to genetically modified, human beta cells as well as methods using such cells. The genetically modified (transgenic), human beta cells express a fugetactic amount of a fugetact...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/071A61P3/10C12N5/0781C12N5/0783A61K35/17
CPCC12N5/0676A61P3/10C12N5/0635C12N5/0638C12N5/0646A61K35/17A61K35/39C07K14/522C12N5/0686C12N2502/11C12N2501/998C12N2510/00C12N2502/99
InventorSWISS, GERALD F.KIEWLICH, DAVID
OwnerSDF BIOPHARMA INC