Method of GTP combining experimental signal window of enlarging GPCR tagging

A technology of isotope labeling and signal window, which is applied in the direction of material inspection products, preparation of test samples, biological testing, etc., can solve the problems of Saponin chemokine receptor effect, negative effect, GPCR no effect, etc. that have not been studied

Inactive Publication Date: 2007-07-18
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although it has been found that Saponin can expand the signal window of isotope-labeled GTP binding experiments of some GPCRs (such as MCH receptors), it has no effect on many GPCRs, and even causes negative effects
At present, those skilled in the art have not studied the effect of Saponin on chemokine receptors (CXCR)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of GTP combining experimental signal window of enlarging GPCR tagging
  • Method of GTP combining experimental signal window of enlarging GPCR tagging
  • Method of GTP combining experimental signal window of enlarging GPCR tagging

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1 Establishment of CHO / CXCR1, CHO / CXCR4, and CHO / CCR5 cell lines

[0085] The target gene was cloned by RT-PCR from the total cDNA library of human leukocytes (source of whole blood: Shanghai Blood Center) to obtain full-length DNA encoding CXCR1, CXCR4 and CCR5 respectively (see below for the primers used to obtain the required DNA). Restriction endonuclease HindIII / XhoI (purchased from Promega) double-digested their full-length DNA and empty plasmid pcDNA3 (purchased from Invitrogen), and then inserted their full-length DNA into pcDNA3 by T4 ligase (purchased from Promega) , were obtained plasmid pcDNA3-CXCR1, pcDNA3-CXCR4 and pcDNA3-CCR5. The sequences of these plasmids were confirmed by sequencing.

[0086] CXCR1 PCR primers:

[0087] P1: 5'TCTAAGCTTACGCGGCGTT3' (SEQ ID NO: 1);

[0088] P2: 5'TACCTCGAGCCTGTCCAGAGA 3' (SEQ ID NO: 2).

[0089] CXCR4 PCR primers:

[0090] P1: 5'TCTAAGCTTAACTTCAGTTTG3' (SEQ ID NO: 3);

[0091] P2: 5'TACCTCGAGAATTCAAATTGATG...

Embodiment 235

[0098] Example 2 [ 35 S] GTPγS binding assay

[0099] 2.[ 35 The general procedure for S]GTPγS binding experiments is as follows:

[0100] ①Collect the corresponding cells obtained in Example 1 that were cultured for 48-72 hours, add cold lysate (5mM Tris-HCl, pH7.5, 5mM EDTA, and 5mM EGTA) and repeatedly pipette the cells 6-7 times with an insulin needle to make the cells crack. Centrifuge at 13000r / min at 4°C for 15 minutes, remove the supernatant and collect the cell membrane pellet.

[0101] ②According to the amount of cell membrane, use an appropriate volume of reaction solution (20mM HEPES, 100mM NaCl, and 5mM MgCl 2 , pH7.4) and resuspended with an insulin needle repeatedly for 6-7 times to form a uniform cell membrane suspension.

[0102] ③Establish the reaction system: the total volume is 100 μl, in which the cell membrane is 10 μg, [ 35 S] GTPγS (purchased from Amersham) 0.5nM (1,200Ci / mmol), GDP (purchased from Sigma) 40μM, then add agonists (both purchased fr...

Embodiment 3

[0108] Add Saponin in the reaction system of embodiment 3 [ 35 S] GTPγS binding assay

[0109] Using the CHO / CXCR1 prepared in Example 1, in step ③ of Example 2, add Saponin at a specified concentration in the reaction system (concentrations are respectively 5 μg / ml, 10 μg / ml, 20 μg / ml, 30 μg / ml, and IL-8 is used as an agonist. Other reaction conditions and operating steps are the same as in Example 2.

[0110] 1. CHO / CXCR1 [ 35 S] The relationship between the signal window of GTPγS binding experiment and the dosage of Saponin

[0111] The results showed that CPM Agonist The curve with the dose of Saponin is peak-shaped, and 10 μg / ml of Saponin can make CPM Agonist Maxed out, CPM Basal It gradually decreased with the increase of Saponin dose (Fig. 2A). The signal window reached its maximum at Saponin 10 μg / ml (Fig. 2B).

[0112] 2.10μg / ml Saponin can maximize the expansion of CHO / CXCR1[ 35 S] Signal window for GTPγS binding experiments

[0113] The results showed that a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a method of combining isotope labeled GTP of magnified chemotaxis factor receptor with experiment signal window and a method of combining isotope labeled GTP with antagonist of experiment screened chemotaxis factor receptor.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for improving drug screening technology, more specifically, the invention relates to increasing GPCR [ 35 S] GTPγS method for binding experimental signal window. Background technique [0002] G protein, guanine nucleotide regulatory protein, can bind and hydrolyze GTP. Structurally, G protein includes three subunits of Gα, Gβ and Gγ, among which Gα is further divided into three types: Gi / o, Gq and Gs. [ 35 S] GTPγS binding assay is a functional assay of Gi / o coupled G protein-coupled receptor (GProtein-Coupled Receptor, GPCR). This experiment can distinguish receptor agonists and antagonists, and is often used in the screening of GPCR small molecule compound drugs. [0003] Chemokines are a group of small molecule cytokines in the body that can induce chemotactic movement of cells. They play a key role in immunity and also affect angiogenesis, collagen production, and hema...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68G01N1/42G01N33/50
Inventor张瑾胡琼莹翟培彬苏杨应锁环陈力裴钢
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI