Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes

A therapeutic drug and hypoglycemic technology, applied in the direction of medical preparations containing active ingredients, drug combinations, recombinant DNA technology, etc., can solve the problems of limited clinical application and short half-life

Inactive Publication Date: 2010-12-15
DALIAN D N BIO ENG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the short half-life of GLP-1 in vivo (only 2-6min), greatly limits its clinical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes
  • Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes
  • Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] The recombinant expression of the long-acting hypoglycemic peptide and its application in diabetes treatment drugs will be further described below in conjunction with the examples:

[0040] Expression of GLPAG-human albumin fusion protein in Pichia pastoris:

[0041] Acquisition of the GLPAG gene:

[0042] First synthesize the following primers (synthesized by Dalian Bao Biological Engineering Co., Ltd.):

[0043] GLP-F1: 5' tactcgagaaaagacatggtgaagggacctttaccagtg 3';

[0044] GLP-R1: 5'tccaaataagaacttacatcactggtaaaggtccc 3';

[0045] GLP-R2: 5' tccttggcagcttggccttccaaataagaacttac 3';

[0046] GLP-R3: 5'accagccaagcaatgaactccttggcagcttggcc 3';

[0047] GLP-R4: 5' tcggcctttcaccagccaagcaatg 3';

[0048] They were spliced ​​into a complete GLPAG gene by fusion PCR, and the spliced ​​sequence is as follows: 5'tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgccaaggagttcattgcttggctggtgaaaggccga 3'; the 5' end of the sequence has xho I restriction endon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

This invention relates to gene cloning and gene expression, more specially, a method for expressing recombinant hypoglycemic peptide with long-lasting effects. The method comprises: mutating the digestion site of dipeptidyl peptidase in GLP-1 from alanine to glycine, ligating with human albumin gene, and expressing in Pichia expression system to obtain four fusion proteins, which comprise recombinant GLP-1, human albumin and flexible linkers. The fusion proteins have such advantage as retained GLP-1 activity, long half-life period, good hypoglycemic effect, and no hypoglycemia phenomenon.

Description

Technical field: [0001] The invention relates to gene cloning and gene expression in the field of molecular biology, and applications in the field of pharmacology. Background technique: [0002] Diabetes has been listed as the third biggest killer after cardiovascular and cerebrovascular diseases and tumors. With the change of life style and diet structure, the prevalence of diabetes among Chinese residents is on the rise. It is estimated that the number of people with diabetes in the world will increase to 366 million by 2030, and diabetes will become a heavy burden in developing countries. [0003] The vast majority of people with type II diabetes will inevitably be treated with medicines. Oral medicines have three categories: the first category is yellow ureas. Such as glyburide, tangshiping, damekang, mepidar; yellow urea drugs can stimulate the islets to secrete insulin, but after excessive insulin secretion, it can cause hypoglycemia, which is a problem that cannot b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63A61K38/16A61P3/10
Inventor 黄庆生李元张明杰李别虎薛小平王延竹韩文君
Owner DALIAN D N BIO ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap