Recombinant phages influenza vaccine
A technology of influenza vaccine and phage, which is applied in the field of medical biology, can solve the problems of unsatisfactory immune effect, virus contamination, and easily outdated antigenicity, and achieve the effect of stable phage particles, low cost, and simple purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] A. Construction of recombinant phage
[0071] A DNA sequence was synthesized by a commercial company. The DNA sequence has been installed on the pGEM-T vector. The 5' end of the DNA sequence contains the restriction site EcoRI, and the 3' end contains the restriction site EcoRV. The DNA sequence encodes the following polypeptide: general Helper T cell epitope, encoded by the gene atgcaatacataaaagccaactcgaagttcataggaataacggaactc; 1-15 amino acid residues of the extracellular domain M2e of the highly conserved envelope protein M of influenza A virus, encoded by the gene atgagtcttctaaccgaggtcgaaacgccgataaggaacgagtgg; spacer GPGPG, encoded by the gene ggtccgggtccgggt; And the 1-21 amino acid residues of the highly conserved envelope protein BM2 of influenza B virus, the coding gene is atgctcgaaccatttcagattctttcaatttgttcttttatcttatcagctctccatttcatg; that is, this DNA sequence codes Th-M2e (1~15) -Spacer-BM2 (1~21) fusion protein.
[0072] Treat the recombinant pGEM-T vecto...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 